METHOD OF IDENTIFYING A CANCER INDIVIDUAL THAT IS PROBABLE TO BENEFIT FROM TREATMENT WITH A COMBINAT

专利摘要:
methods of diagnosing and treating cancer in patients who have or develop resistance to early cancer therapy. A method of identifying an individual who has cancer who is likely to benefit from treatment with a combination therapy with a raf inhibitor and a second inhibitor is provided. A method of treating cancer in an individual in need thereof is also provided and includes administering to the individual an effective amount of a raf inhibitor and an effective amount of a second inhibitor, wherein the second inhibitor is a mek inhibitor, a craf inhibitor. a crk1 inhibitor or a tpl2 / cot inhibitor. A method of identifying a target kinase that confers resistance to a first inhibitor is also provided.
公开号:BR112012022801B1
申请号:R112012022801-3
申请日:2011-03-09
公开日:2019-10-15
发明作者:Levi A. Garraway；Cory M. Johannessen
申请人:Dana-Farber Cancer Institute, Inc.；The Broad Institute, Inc.；
IPC主号:

专利说明:

RELATED APPLICATIONS [0001] This application claims the benefit of the filing date under 35 U.S.C. §119 (e) of the following U.S. Provisional Patent Applications Serial Nos .: 61 / 312,193, filed on March 9, 2010; 61 / 312,519, deposited on March 10, 2010; 61 / 326,021, filed on April 20, 2010; and 61 / 415,569, deposited on November 19, 2010, all of which are hereby incorporated by reference in their entirety.
RESEARCH OR DEVELOPMENT SPONSORED BY THE FEDERAL GOVERNMENT [0002] This invention was made with government support under federal grants numbers K08 CA115927 and 1DP20D002750 granted by the National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND [0003] Oncogenic mutations in serine / threonine kinase B-RAF (also known as BRAF) are found in 50 to 70% of malignant melanomas. (Davies, H. et al., Nature 417, 949-954 (2002)). Preclinical studies have shown that the B-RAF mutation (V600E) predicts a dependence on the mitogen-activated protein kinase (MAPK) signaling cascade in melanoma (Hoeflich, KP et al., Cancer Res., 69, 3042 -3051 (2009); McDermott, U. et al., Proc. Natl Acad. Sci. USA 104, 19936-19941 (2007); Solit, DB et al. BRAF mutation predicts sensitivity to MEK inhibition. Nature 439, 358- 362 (2006); Wan, PT et al., Cell 116, 855-867 (2004); Wellbrock, C. et al., Cancer Res., 64, 2338-2342 (2004)) - an observation that has been validated by the success of RAF or MEK inhibitors in clinical trials (Flaherty, KT et al., N. Engl. J. Med., 363, 809-819 (2010); Infante, JR et al., J. Clin. Oncol. , 28 (supl)., 2503 (2010); Schwartz, GK et al., J.
Petition 870190065596, of 07/12/2019, p. 7/131
2/120
Clin. Oncol., 27 (suppl.), 3513 (2009)). However, clinical responses to targeted anti-cancer therapeutic products are often confused by de novo or acquired resistance. (Engelman, JA et al., Science 316, 1039-1043 (2007); Gorre, Μ. E. et al., Science 293, 876-880 (2001); Heinrich, MC et al., J. Clin. Oncol ., 24, 4764-4774 (2006); Daub, H., Specht, K. & Ullrich, A. Nature Rev. Drug Discov., 3, 1001-1010 (2004)). Consequently, there remains a need for new methods for identifying resistance mechanisms in a way that elucidates targets “that can be turned into drugs” for effective long-term treatment strategies, as for new methods of identifying patients who are likely to benefit from treatment strategies, and how to treat patients with effective long-term treatment strategies.
SUMMARY [0004] The present invention concerns the development of resistance to therapeutic agents in the treatment of cancer and the identification of targets that confer resistance to the treatment of cancer. The present invention also concerns the identification of parallel drug targets to facilitate an effective long-term treatment strategy and to identify patients who would benefit from such treatment.
[0005] Consequently, in one aspect, a method of identifying an individual having cancer who is likely to benefit from treatment with a combination therapy with an RAF inhibitor and a second inhibitor is provided. The method includes testing a gene copy number, an mRNA or a protein level or phosphorylation of one or more kinase targets selected from the group consisting of MAP3K8 (TPL2 / COT), RAF1 (CRAF), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2), AXL (Axl), or PAK3 (Pak3) in cancer cells obtained from the individual. The method further includes comparing the gene copy number, mRNA or protein level or phosphorylation with a gene copy number, an mRNA or a protein level or kinase phosphorylation target in cells obtained from an individual without the cancer and correlate the copy number of
Petition 870190065596, of 07/12/2019, p. 8/131
3/120 increased gene or a change in mRNA expression or overexpression or phosphorylation of the target kinase protein in cancer cells in relation to the cells of the individual without the cancer with the individual having the cancer that is likely to benefit from treatment with combination therapy.
[0006] In another aspect, a method of treating cancer in an individual in need of it is provided. The method includes administering to the individual an effective amount of an RAF inhibitor and an effective amount of a second inhibitor, wherein the second inhibitor is an MEK inhibitor or a TPL2 / COT inhibitor.
[0007] In another aspect, a method of identifying a target kinase that confers resistance to a first inhibitor is provided. The method includes culturing cells that are sensitive to the first inhibitor and expressing a plurality of kinase ORF clones in cell cultures, each cell culture expressing a different kinase ORF clone. The method further includes exposing each cell culture to the inhibitor and identifying cell cultures that are more viable than a control cell culture after exposure to the inhibitor to identify the kinase ORF clone that confers resistance to the first inhibitor.
BRIEF DESCRIPTION OF THE DRAWINGS [0008] Figure 1 illustrates a functional ORF-based screening that identified the COT and Cd RAF kinases as resistance controllers for BdRAF inhibition. (a) Schematic overview of the CCSB / Broad Institute Kinase ORF collection. The kinase classification and the number of kinases per classification are recorded; (b) A375 cells expressing the ORS collection of the CCSB / Broad Institute Kinase were tested for relative viability in 1 μΜ of PLX4720 and normalized to constitutively active MEK1 (MEK1DD). Nine ORFs (circles) counted 2 standard deviations (dashed line, 58.64%) from the average of all ORFs (dashed line, 44.26%); (c) The indicated ORFs were expressed in cell lines 5 BdRAF ^V600E and treated with DMSO or 1 μΜ of PLX4720. Viability (relative to DMSO) was quantified after 4 days. Error bars represent
Petition 870190065596, of 07/12/2019, p. 9/131
4/120 standard deviation between copies (n = 6); (d) Secondary screening on A375 and SKMEL28 prioritizes ORFs from 9 top candidates using a multi-point PLX4720 concentration scale.
[0009] Figure 2 illustrates resistance to BDRAF inhibition through activation of the MAPK pathway. (a) The indicated ORFs were expressed in A375. The phosphorylated MEK and ERK levels were tested after 18 h. Treatment with DMSO (□) or PLX4720 (mentioned concentration); (b) Proliferation of A375 that expresses the indicated ORFs. The error bars represent the standard deviation between copies (n = 6). (c) Cd RAF (S338) and ERK phosphorylation in A375 lysates that express the indicated ORFs, (d) the COT expression in immortalized primary melanocyte lysates that express BRAFV600E or empty vector. The COT mRNA has an internal start codon (30M) that results in two protein products of different lengths; amino acids 1 to 467 or 30 to 467, indicated with arrows, (e) the phosphorylation of COT and ERK in A375 lysates expressing ORFs indicated after shRNA-mediated BdRAF depletion (shBRAF) in relation to the control shRNA (shLuc). (f) ERK phosphorylation in A375 lysates that express the ORFs indicated after shRNA-mediated Cd RAF depletion (shCRAF) or control shRNA (shLuc), after 18 h of treatment with DMSO (D) or 1 μΜ of PLX4720 (+).
[0010] Figure 3 illustrates resistance to COT expression prognosis for BdRAF inhibition in cancer cell lines, (a) MAP3K8 / COT copy number; red bars: TOC amplification, blue bars: non-amplified TOC; (b) expression in TOC BdRAF ^V600E cell lines and (c) short - term cultures; (d) in PLX4720 GI50 BdRAF ^V600E cell lines. The colors as in (a); (e) phosphorylation of MEK and ERK following treatment with DMSO or PLX4720 (indicated concentration); (f) ERK phosphorylation in M307 lysates (AZDDR; AZD6244 resistant) treated with DMSO or 1 μΜ of PLX4720 (PLX) or CID1040 (Cl); (g) expression of COT mRNA (QRT / PCR) in tissue samples of metastatic melanoma treated with PLX4032 matched with patient / lesion. Patients 1 and 3 had multiple biopsies of the same lesion. The error bars
Petition 870190065596, of 07/12/2019, p. 10/131
5/120 represent SEM (n = 3) U; undetermined / undetectable; (h) phosphorylation of ERK and MEK in RPMID7951 following shRNA-mediated TOC depletion (shCOT) versus control (shLuc) and treatment with DMSO (□) or 1 μΜ of PLX4720 (+). The phosphorylation of ERK and MEK is quantified; (i) phosphorylation of ERK and MEK in RPMID7951 following 1 hour of treatment with a small molecule COT kinase inhibitor. The phosphorylation of ERK and MEK is quantified, (j) PLX4720 sensitivity curves in a panel of BRAF ^V600E cell lines. OUMS23 and M307 represent cell lines with TOC expression / amplification and all others represent cell lines with undetectable / unchanged TOC; (k) Selective TOC expression and activation of the corresponding MAPK pathway in a metastatic subcutaneous malignant melanoma with acquired resistance for PLX4032 (* indicates a background band, MET-MM (PLX-R); metastatic malignant melanoma, resistant to PLX4032) .
[0011] Figure 4 illustrates BDRAFV600E cell lines that express COT that exhibit resistance to allosteric MEK inhibitors. (a) CID1040 in a panel GI50 BdRAF ^V600E cell lines; (b) phosphorylation of MEK and ERK in lysates of the indicated cell lines treated with DMSO or Cl □ 1040 (mentioned concentration); (c) Multiple changes (in relation to MEK1) GI50 of A375 that ectopically expresses the ORFs indicated for PLX4720, RAF265, CID1040 and AZD6244; (d) phosphorylation of ERK in A375 that expresses the ORFs indicated after treatment with DMSO or 1 μΜ of PLX4720, RAF265, CID1040 or AZD6244; (e) Viability of A375 expressing the indicated ORFs and treated with DMSO, PLX4720 (indicated concentration) and PLX4720 in combination with Cl □ 1040 or AZD6244 (all 1 μΜ). The error bars represent the standard deviation (n = 6); (f) phosphorylation of ERK in A375 that expresses the ORFs indicated after treatment with DMSO, PLX4720 (1 μΜ) or PLX4720 in combination with Cl □ 1040 or AZD6244 (all 1 pM); (g) The aberrant MAP3K8 / COT copy / expression cell lines are insensitive to the MEK CI-1040 allosteric inhibitor or (h) AZD6244; (i) A schematic that outlines the formation of MAP3K complexes in response to B-RAF inhibition in cell lines
Petition 870190065596, of 07/12/2019, p. 11/131
6/120 mutant B-RAF ^V600E . PLX4720 positions C-RAF in a competent signaling complex (upper right panel) that is activated by oncogenic events upstream of C-RAF (lower right panel), which subsequently controls resistance. In the context of COT expression, complexes containing COT / RAF are sufficient to activate the MAPK path and mediate resistance (lower left panel).
[0012] Figure 5 illustrates a schematic outline of an ORF-based functional screening for kinases that control resistance to B-RAF inhibition. The B-RAF cell line ^V600E A375 was lentiviral transduced with the 597 kinases in the CCSB / Broad Institute Kinase ORF Collection. ORFs having a positive or negative effect on proliferation in A375 treated with control were identified and removed from the final analysis. ORFs that promote resistance have been identified by generating a differential viability ratio between cells inhibited by B-RAF (treated with PLX4720) and treated with control. Differential viability was normalized with a constitutively active MEK1 allele, MEK1 ^DD ; specific test positive control.
[0013] Figure 6 illustrates that the CCSB / Broad Institute Kinase ORF Collection is well expressed through high-tier lentivirus, (a), schematic of the pLX-BLAST-V5 lentiviral expression vector used for all ORF screens and subsequent validation, (b) ORFs labeled with GFP that represent a wide size range were lentiviral expressed in Jurkat cells and the percentage of cells / ORF expressing GFP (for example, infected cells) quantified, demonstrating a high viral titer through a ORF size range. (c), expression of 96 random ORFs detected using LiCor with antibodies against the epitope label epitope label V5, in relation to cellular DNA. The expression was detectable in 83% of the reservoirs.
[0014] Figure 7 illustrates the expression of candidate resistance ORFs. 293T were transiently transfected with pLX-BLAST-V5-ORF (indicated) and expression detected using an anti-V5-HRP antibody. The AXL clone is 'closed' and has a stop codon preceding the V5 label. See Figure 12 for verification
Petition 870190065596, of 07/12/2019, p. 12/131
7/120 of the expression; (*) in the dark exposure indicate the expression of three ORFs not visible in the lightest exposure.
[0015] Figure 8 illustrates that a secondary screening prioritizes the top 9 candidates from the B-RAF inhibitor resistance ORFs. The nine top ORFs that count in the primary screening were expressed in A375 or SKMEL28 and a Gho from an 8 point PLX4720 concentration range.
[0016] Figure 9 illustrates the effects of ORF expression on proliferation in B-RAF ^V600E cell lines. The proliferation, in relation to MEK1, in (a) A375 or (b) SKMEL28 that express the indicated ORFs after 7 days of growth.
[0017] Figure 10 illustrates that the ectopic expression of MEK1 (MEK1 ^DD ) and constitutively active COT leads to A375 increased pMEK / pERK, while CRAF reduces pMEK / pERK levels. A375 lysates that ectopically express GFP, MEK1, MEK ^DD , COT or C-RAF were analyzed by immunoblotting for the levels of pERK and pMEK. GFP and MEK1 (lines 1 to 3) were separated from COT / C-RAF (lines 4 and 5) to prevent the residual V5-MEK1 signal from overcoming that of COT and C-RAF, which are expressed at much lower levels .
[0018] Figure 11 illustrates that COT and C-RAF kinase activity is required for prolonged ERK phosphorylation in the context of treatment with PLX4720. Immunoblot analysis of A375 expressing ectopic (a) MEK1, wild type COT or kinase inactive COT (COT ^K167R ) or (b) MEK1, wild type C-RAF or kinase inactive C-RAF (C-RAF ^K375M ) treated with 1 μΜ of PLX4720 for 18 h.
[0019] Figure 12 illustrates the effects of ORF expression on MAPK signaling in the context of the B-RAF inhibitor PLX4720. The activation of the MAPK pathway was evaluated by the immunoblot analysis of pERK and pMEK in A375 that express the ORFs indicated in the presence of PLX4720 (18 h., Indicated concentration). (*) indicates the use of an antibody directed against the expressed ORF, not the V5 epitope. AXL was cloned without the V5 label.
[0020] Figure 13 illustrates that B-RAF associates with immunoprecipitated C-RAF
Petition 870190065596, of 07/12/2019, p. 13/131
8/120 on A375 after 18 hr. of treatment with 1 μΜ of PLX4720 (+) or DMSO (-), (a). WCE; whole cell extract controls. Ectopically expressed C-RAF constitutively associates with B-RAF and is phosphorylated in S338, compatible with the location and activation of the membrane. A375s that express MEK1, MEK ^DD and COT do not show any evidence of C-RAF activation, (b).
[0021] Figure 14 illustrates that retroviral expression of a wild-type C-RAF or a high-activity C-RAF truncation mutant (C-RAF (22W)) takes A375 resistant to the B inhibitor PLX4720 (a) and leads to prolonged pERK levels in the context of treatment with PLX4720 (1 μΜ, 18 h.), (b). expression levels of C-RAF obtained with retroviruses are significantly lower than with lentiviral-based systems, resulting in a lower Gho than that obtained with lentiviral C-RAF.
[0022] Figure 15 illustrates the effects of B-RAF ^V600E on the COT mRNA (a) RT / PCR quantitative of the expression of the COT mRNA in relation to the expression of the GAPDH mRNA in transformed primary melanocytes that express B-RAF of the wild type (vector) or B-RAF ^V600E . The TOC expression was normalized to that of primary melanocytes that express the vector. (**) Significant, p 0.05 (two-tailed, paired Student T test). The endogenous COT mRNA is undetectable in A375 sensitive to PLX4720 and ectopically expressed COT mRNA levels are unaffected by treatment with 1 μΜ of PLX4720. A375 expressing GFP or COT were treated for 18 h. with 1 μΜ of PLX4720. The reverse transcribed mRNA was analyzed for the expression of normalized TOC with GAPDH, in relation to A375 that express GFP, treated with DMSO. (*) Not significant, p> 0.05 (two-tailed, paired Student's T test). The error bars represent SEM.
[0023] Figure 16 illustrates that B- and C-RAF protein levels are not required for COT-mediated ERK phosphorylation. A375 that express ectopic MEK1 (control) or TOC were sequentially infected with lentiviruses that express shRNAs targeting B-RAF, C-RAF or control shRNA (shLuc) and tested for the expression of the proteins indicated in the presence (+) or
Petition 870190065596, of 07/12/2019, p. 14/131
9/120 absence (-) of 1 μΜ of PLX4720, 18 h.
[0024] Figure 17 illustrates the SNP analysis of 752 cell lines reveals changes in the copy number in MAP3K8 / COT. Of the 752 cell lines that went through the copy number analysis, 534 also went through the definition of the mutation profiles. Thirty-eight (7.1%) of the cells defined in the mutation profiles in the protection of the B-RAF ^{V600E mutation} . Two cell lines (OUMS-23, RPMI-7951, indicated) protect the B-RAF ^{V600E mutation} together with the copy number gain in MAP3K8 / COT.
[0025] Figure 18 illustrates the changes in MAP3K8 / COT in the cancer cell line OUMS-23. (a) The RMA signal from a MAP3K8 / COT probe (mentioned) from the mRNA microarray analysis. OUMS-23 is one of the top 2% (out of 765 cell lines) that express COT mRNA. (b) the expression of COT mRNA in a panel of BRAFV6ooe mutant cell lines ( _C ) the expression of endogenous COT protein in OUMS-23 in relation to ecotically expressed COT in A375 and SKMEL28 cell lines, as determined by means of immunoblot analysis of the indicated cells.
[0026] Figure 19 illustrates that COT mRNA and protein are expressed in cell and tissue lines resistant to the B RAF inhibitor. (a) RT / PCR analysis of the expression of normalized COT mRNA in GAPDH in a panel of cell lines, short-term cultures and malignant melanoma relapse tissue, treated with PLX4032, (MM-R). The expression of the corresponding protein to the cell lines and short term culture are shown in Figures 3b and 3c, respectively, (b) Western blot analysis of lysates from primary melanocytes (1 Mel (B-RAF WT)), Normal matched to the patient 's skin (skin) and metastatic melanoma (MM-R; mRNA TOC shown in panel a ), A375 cells and primary melanocytes expressing ^V600E B-RAF (1 Mel (B-RAFV600E)).
[0027] Figure 20 illustrates that COT depletion affects viability in the COT amplified cell line RPMI-7951. (a) Quantification of the viability of RPMI-7951 following LOT depletion mediated by lentiviral shRNA (shCOT), in relation to the control shRNA (shLuc). The error bars represent the deviation
Petition 870190065596, of 07/12/2019, p. 15/131
10/120 standard among replicates, (b) immunoblot analysis showing relative COT protein expression in RPMI-7951 that expresses shLuc and shCOT.
[0028] Figure 21 illustrates the effects of ORF expression on Gho from a panel of MAPK pathway inhibitors in SKMEL28. The SKMEL28 half-maximum growth inhibitory concentration (Gho) that ectopically expresses MEK1, MEK1 ^DD or COT was determined for the RAF PLX4720 and RAF265 inhibitors and the MEK1 / 2 inhibitors CI-1040 and AZD6244. The change in Gho to MEK1 ^DD and COT (in relation to MEK1) was determined for each compound.
[0029] Figure 22 illustrates that COT can activate ERK through MEK-independent and MEK-dependent mechanisms. (a) Immunoblot analysis of ERK phosphorylation in A375 lysates following GFP or COT expression and subsequent depletion of MEK1, MEK2 or MEK1 and MEK2 (MEK1 + 2) mediated by the lentiviral shRNA, in relation to the control shRNA ( shLuc). The left and right panels represent two different pairs of shRNA constructs from MEK1 and MEK2. (b) Immunoblot staining analysis of recombinant, inactive ERK phosphorylation (Thr202 / Tyr204) by recombinant COT in an in vitro kinase assay.
[0030] Figure 23 illustrates that inhibition of the combinatorial MAPK pathway effectively suppresses proliferation in SKMEL28. The viability (in relation to DMSO) of SKMEL28 that ectopically expresses MEK1, MEK1 ^DD or COT and treated with DMSO, PLX4720 (indicated concentration), PLX4720 (1 μΜ) and CI-1040 (1 μΜ) or PLX4720 (1 μΜ) and AZD6244 (1 μΜ). The error bars represent the standard deviation between replicates.
[0031] Figure 24 illustrates that overexpression of TOC is sufficient to make cancerous melanoma cells with the B-RAF ^{V600E mutation} resistant to B-RAF inhibition.
[0032] Figure 25 illustrates the nine top ORFs that count in the primary screening were expressed in (a) SKEL28 of (b) A375 and aGI50 is shown for 4 MAPK pathway inhibitors (PLX4720, RAF265, CI-1040, AZD -6244).
[0033] Figure 26 illustrates that the expression of CRKL modifies the sensitivity
Petition 870190065596, of 07/12/2019, p. 16/131
11/120 for the selective B-RAF inhibitor PLX4720 in a panel of B-RAFv600E cell lines.
[0034] Figure 27 shows that the mutant cancerous cell lineage amplified in MAP3K8 / COT / ^V600E B-RAF OUMS-23 shows constitutive phosphorylation of ERK / MEK over a dose range of PLX4720.
[0035] Figure 28 illustrates that insensitivity to MAPK pathway inhibition corresponds to the copy number gains of MAP3K8 / COT in a subset of skin cancer cell lines. A panel of 20 cell lines ^V600E mutant B-RAF and sensitivity (a) to B-RAF inhibitor is PLX4720 and (b) the MEK inhibitor AZD6244 is shown.
DETAILED DESCRIPTION OF THE INVENTION [0036] The present invention relates to the development of resistance to therapeutic agents in the treatment of cancer and identification of targets that confer resistance to the treatment of cancer. The present invention also concerns the identification of parallel drug targets to facilitate an effective long-term treatment strategy and to identify patients who would benefit from such treatment. In some embodiments, the present invention concerns kinases and in particular components of the MAP kinase pathway.
[0037] The practice of the present invention will use, unless otherwise indicated, conventional techniques of molecular biology, immunology, microbiology, cell biology and recombinant DNA, which are within the skill of the art. See for example, Sambrook, Fritsch and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, (Current Edition); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel et al. Eds., (Current Edition)); the METHODS IN ENZYMOLOGY series (Academic Press, Inc) .: PCR 2: A PRACTICAL APPROACH (Current Edition) ANTIBODIES, A LABORATORY MANUAL AND ANIMAL CELL CULTURE (R. I. Freshney, ed. (1987)). DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed) .; Oligonucleotide Synthesis (N. Gait, ed., Current Edition); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., Current Edition); Transcription and Translation (B. Hames & S. Higgins, eds., Current Edition);
Petition 870190065596, of 07/12/2019, p. 17/131
12/120
Fundamental Virology, 2nd Edition, Vol. I & II (BN Fields and DM Knipe, eds).
[0038] The mitogen-activated protein kinase cascade (MAPK) is a critical intracellular signaling pathway that regulates signal transduction in response to various extracellular stimuli, which include growth factors, cytokines, and proto-oncogenes. Activation of this pathway results in activation of the transcription factor and changes in gene expression, which ultimately leads to changes in cell functions that include cell proliferation, cell cycle regulation, cell survival, angiogenesis and cell migration. Classical MAPK signaling is initiated by receptor tyrosine kinases on the cell surface, however many other cell surface molecules are able to activate the MAPK cascade, which includes integrins, heterotrimeric G proteins, and cytokine receptors.
[0039] Binding of ligand to a cell surface receptor, for example, a tyrosine kinase receptor, typically results in phosphorylation of the receptor. The adapter protein Grb2 associates with the phosphorylated intracellular domain of the activated receptor, and this association recruits exchange factors for the guanine nucleotide that includes SOS-I and CDC25 for the cell membrane. These guanine nucleotide exchange factors interact with and activate GTPase Ras. Common Ras isoforms include K-Ras, N-Ras, H-Ras and others. Following Ras activation, Raf serine / threonine kinase (for example, A-Raf, B-Raf or Raf-1) is recruited to the cell membrane through interaction with Ras. Raf is then phosphorylated. Raf directly activates MEK1 and MEK2 by phosphorylation of two serine residues at positions 217 and 221. Following activation, MEKI and MEK2 phosphorylate the tyrosine (Tyr-185) and threonine (Thr-183) residues in serine / threonine kinases Erk1 and Erk2, resulting in the activation of Erk. Activated Erk regulates many targets in the cytosol and also moves to the nucleus, where it phosphorylates various transcription factors that regulate gene expression. Erk kinase has numerous targets, which include Elk-I, c-Ets1, c-Ets2, p90RSKI, MNKI, MNK2, MSKI, MSK2 and TOB. Although the preceding path is a classic representation of MAPK signaling, there is considerable cross-talk between the MAPK path and other signaling cascades.
Petition 870190065596, of 07/12/2019, p. 18/131
13/120 [0040] The aberrations in MAPK signaling have a significant role in the biology of cancer. The altered expression of Ras is common in many cancers, and activating mutations in Ras have also been identified. Such mutations are found in up to 30% of all cancers, and are especially common in pancreatic (90%) and colonic (50%) carcinomas. In addition, the activation of Raf mutations has been identified in melanoma and ovarian cancer. The most common ^mutation , BRAF ^V600E , results in the constitutive activation of the downstream MAP kinase pathway and is required for melanoma cell proliferation, the growth of soft agar, and the formation of tumor xenograft. Based on the defined role of excessive MAPK activation in human cancers, targeting components of the MAPK pathway with specific inhibitors is a promising method for cancer therapy. However, patients may have innate resistance or acquired resistance to these promising therapies. The identification of target kinases, diagnostic and / or prognostic markers and treatment therapy for these patients with innate or acquired resistance are described below.
[0041] High Yield Functional Screening Assay [0042] In some respects, the present invention relates to methods of identifying targets capable of inducing resistance to clinically effective therapies using a high throughput screening assay. In some embodiments, the method may include functional screening based on the open reading matrix (ORF) for kinases that induce resistance to therapeutic agents. The method may include providing a cell line with a kinase known to have an oncogenic mutation. A library of kinase ORFs can be individually expressed in the cell line so that a plurality of clones each expressing a different ORF from the library can be further evaluated. Each clone can be (1) exposed to a known kinase inhibitor in the cell line and (2) monitored for changes in growth based on the expression of ORF in the cell line without the inhibitor. Any of the clones that have a growth effect from just ORF expression, positive or negative growth, are eliminated. The remaining clones each
Petition 870190065596, of 07/12/2019, p. 19/131
14/120 um expressing a different kinase are then compared for viability between a control clone and a treated one and normalized to a positive control. The increased cell viability after treatment with the inhibitor identifies ORFs that confer resistance and therefore identifies target kinases to be treated with an additional inhibitor. In some embodiments, clones that count above two standard deviations from the normalized mean may be targets for the kinase indicating that treatment with an additional inhibitor is beneficial to the individual. [0043] By way of non-limiting example, a schematic of a high-throughput functional screening assay for kinases that induce resistance to B-RAF inhibition is shown in Figure 5. A collection of ~ 600 ORFs cloned and validated in sequence was assembled, considering ~ 75% of all annotated kinases (Center for Cancer Systems Biology (CCSB) ZBroad Institute Cinase ORF Collection, Figs. 1a, 1b, Table 3). This publicly available collection can be quickly transferred into a variety of expression vectors for various end applications. Any type of expression vector known to a person skilled in the art can be used to express the kinase ORF collection. By way of non-limiting example, a selectable expression vector, labeled by epitope, lentiviral capable of producing high-titer viruses and robust ORF expression in mammalian cells can be created to express the kinase collection, (pLXBLAST-V5, Figure 6a).
[0044] To identify kinases capable of preventing RAF inhibition, the ORF collection of the arranged kinase can be stably expressed in A375, a malignant melanoma cell line of B-RAF ^V600E that is sensitive to the RAF kinase inhibitor PLX4720 (Figs 1a, 1b and 6c, Table 3). Clones of cells expressing ORF treated with 1 μΜ of PLX4720 are screened for viability relative to untreated and normalized cells for a specific assay specific control, MEK1 ^{S218 / 222D} (MEK1 ^DD ) (Table 4). ORFs that have affected the reference viability or proliferation are removed from the analysis. Clones that count above two standard deviations from the normalized mean can be further evaluated to identify a target kinase that confers resistance for one second
Petition 870190065596, of 07/12/2019, p. 20/131
15/120 inhibitor. In some embodiments, the gene encoding the target kinase may be MAP3K8 (TPL2 / COT), RAFI (CRAF), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2 ), AXL (Axl), or PAK3 (Pak3). In some embodiments, the gene encoding the target kinase may be an activator of the MAPK pathway. In some embodiments, the gene encoding the target kinase may be a MAP3 kinase that directly phosphorylates and activates MEK. In some embodiments, the gene encoding the target kinase can encode an adapter protein that is amplified and phosphorylated in melanoma.
[0045] In other embodiments, the ORF collection can be stably expressed in a cell line having a different mutation in B-RAF, for example, another mutation in the amino acid position of about 600 such as V600K, V600D , and V600R. Additional B-RAF mutations include the mutations described in Davies et al. Nature, 417, 949-954, 2002, Table 1. Cell lines can be used that are sensitive to other RAF kinase inhibitors including, but not limited to, PLX4032; GDC-0879; RAF265; sorafenib; SB590855 and / or ZM 336372. In some embodiments, the ORF collection can be stably expressed in a cell line having a sensitivity to a MEK inhibitor. Non-limiting examples of MEK inhibitors include, AZD6244; CI-1040; PD184352; PD318088, PD98059, PD334581, RDEA119, 6-Methoxy-7- (3-morpholin-4-yl-propoxy) -4- (4-phenoxy-phenylamino) -quinoline-3carbonitrile and 4- [3-Chloro-4- ( 1-methyl-1 H-imidazol-2-ylsulfanyl) -phenylamino] -6-methoxy-7- (3morpholin-4-yl-propoxy) -quinoline-3-carbonitrile. Additional RAF and MEK inhibitors are described below. By way of non-limiting example, exemplary RAF inhibitors are shown in Table 1 and exemplary MEK inhibitors are shown in Table 2.
[0046] Table 1: Exemplary RAF inhibitors
Name CAS No. Structure
Petition 870190065596, of 07/12/2019, p. 21/131
16/120
1 RAF265 927880-90- at /hn to IJI ΪF F 2 Sorafenib TosylateNexavarBay 43-9006 475207-59-1 0 u. .1.0 '° u ^r li liSorafenib4- [4 - [[4-chloro-3- (trifluoromethyl) phenyl] carbamoylamino] oxy] -Nmethyl-pyridine-2-carboxamide 284461-73-0 Cl. , ~ xx · HN ' 1 .o. A ^F FAXJ l o · 'rr H 3 SB59088501 ^H 3 ^n_ T /> - ^ -o HON 4 PLX4720 918505-84-7 yUo ^α γχχ m & 5 PLX4032 1029872-54-5 HN - __ K __ / ^cl V ^ i ⁿ b
Petition 870190065596, of 07/12/2019, p. 22/131
17/120
[0047] Table 2: Exemplary MEK inhibitors
Name CAS No. Structure 1 CI-1040 / PD184352 212631-79-3 Ο Λ AA; ^F dr ^cl 1 2 AZD6244 606143-52-6 HHÇ., Λ A.° γ h í T Ϊ] ^ Nj ^ F 3 PD318088 391210-00-7 < ^M H Vo'Y „ _I OH ITT 1 B '·' yr F
Petition 870190065596, of 07/12/2019, p. 23/131
18/120
4 PD98059 167869-21-8 O 5 PD334581O— N - R ^hn V'n X) r 'vT ^F F 6 RDEA119N- [3,4-difluoro-2 - [(2fluoro-4-iodophenyl) amino] 6-methoxyphenyl] -1 - [(2R) -2,3dihydroxypropyl] cyclopropanesulfonamide 923032-38-6 1FQH HN ^ Jx-Fy y° H 7 6-Methoxy-7- (3-morpholin-4-yl-propoxy) -4- (4-phenoxyphenylamino) -quinolin-3carbonitrileL___N N r ^. <^^ ^NH 8 4- [3-Chlorine-4- (1-methyl-1H-imidazol-2-ylsulfanyl) phenylamino] -6-methoxy-7- (3morpholin-4-yl-propoxy) quinoline-3-carbonitrile° ^ ΊL___N Nthe XY
[0048] Diagnostic / Prognostic Markers for Innate Resistance and
Acquired for Targeted Therapies
Petition 870190065596, of 07/12/2019, p. 24/131
19/120 [0049] In some respects, the present invention relates to methods of detecting the presence of one or more diagnostic or prognostic markers in a sample (for example a biological sample from a cancer patient). A variety of screening methods known to a person skilled in the art can be used to detect the presence of the marker in the sample that includes DNA, RNA and protein detection. The techniques described below can be used to determine the presence or absence of a target kinase in a sample obtained from a patient. In some embodiments, the patient may have innate or acquired resistance to therapies targeted by the kinase, which includes BRAF inhibitors or MEK inhibitors. For example, the patient may have innate or acquired resistance to B-RAF inhibitors PLX4720 and / or PLX4032. In some embodiments, the patient may have innate or acquired resistance to the MEK inhibitor AZD6244. The identification of one or more target kinase markers in a patient helps the physician in determining a treatment protocol for the patient. For example, in a patient having one or more target kinase markers, the physician may treat the patient with combination therapy as described in more detail below.
[0050] In some embodiments, the target kinase may include, but is not limited to, MAP3K8 (TPL2 / COT), RAF1 (CRAF), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH ( Prkch), ERBB2 (ErbB2), AXL (Axl), or PAK3 (Pak3). The marker may be an increase in the gene copy number, an increase in protein expression, phosphorylation of one or more members of the MAP kinase pathway, a change in mRNA expression and the like, for the target kinase.
[0051] By way of non-limiting example, in a patient having an oncogenic mutation in B-RAF, the identification of an activated kinase target can be useful to characterize a treatment protocol for the patient. For example, in a patient having a B-RAF ^{V600E mutation} , treatment with an RAF inhibitor alone may indicate that the patient is at a relatively high risk of acquiring resistance to treatment after a period of time. In a patient having an oncogenic mutation, identifying an activated kinase target in which the
Petition 870190065596, of 07/12/2019, p. 25/131
20/120 patient may indicate the inclusion of a second inhibitor in the treatment protocol. [0052] The identification of an activated kinase target may include an analysis of a gene copy number and identification of an increase in the copy number of a target kinase. For example, a gain in the copy number in MAP3K8 is indicative of a patient who has innate resistance or who develops acquired resistance, particularly if the patient also has a B-RAF ^{V600E mutation} . [0053] In some embodiments, the identification of an activated kinase target may include an analysis of the phosphorylation of a target kinase and / or a member of the MAP kinase pathway. For example, phosphorylation of C-RAF in S338 is indicative of a patient who has innate resistance or who develops acquired resistance, particularly if the patient also has a BRAF ^{V600E mutation} . In some embodiments, the identification of an increase in MEK / ERK phosphorylation may be indicative of a patient who has innate resistance or who develops acquired resistance. Expression of the increased COT protein in patients who have a B-RAF ^{V600E mutation} can predict resistance to RAF inhibition and MEK inhibition.
[0054] The identification of an activated kinase target may include an analysis of mRNA expression from a target kinase. For example, an increase in COT mRNA expression following initial treatment with a first kinase inhibitor is indicative of a patient who has or develops resistance. In some embodiments, the first kinase inhibitor can be an RAF inhibitor or a MEK inhibitor.
[0055] Methods of treatment [0056] In various embodiments, the invention provides methods for treating a patient who has cancer. The methods in general comprise the administration of a first inhibitor and a second inhibitor. An inhibitor can be an RAF inhibitor. The RAF inhibitor can be a pan-RAF inhibitor or a selective RAF inhibitor. Pan-RAF inhibitors include but are not limited to RAF265, sorafenib, or SB590885. In some embodiments, the RAF inhibitor is a B-RAF inhibitor. In some embodiments, the RAF inhibitor
Petition 870190065596, of 07/12/2019, p. 26/131
Selective 21/120 is PLX4720, PLX4032, or GDC-0879-A. An inhibitor can be a MEK inhibitor (see Table 2 which illustrates exemplary MEK inhibitors). An inhibitor can be a COT inhibitor. By way of non-limiting example, the COT inhibitor can be a shRNA inhibitor as described below or a small molecule, 4- (3-chloro-4-fluorophenylamino) -6- (pyridin-3-yl- methylamino) -3-cyano- [1,7] naphthyridine (EMD; TPL2 inhibitor I; catalog number 616373, PubChem ID: 9549300). The inhibitors of the present invention inhibit one or more of the target kinases that include MAP3K8 (TPL2 / COT), RAF1 (CRAF), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2) , AXL (Axl), or PAK3 (Pak3) or other targets in the MAP kinase pathway.
[0057] In some embodiments, a combination therapy for cancer is provided, which comprises an effective amount of an RAF inhibitor and an effective amount of a MAP3K8 inhibitor (TPL2 / COT). A combination therapy for cancer is also provided here, comprising an effective amount of an RAF inhibitor and an effective amount of a MEK inhibitor. Other combination therapies include an effective amount of an RAF inhibitor and an effective amount of a second inhibitor that targets the gene, mRNA or protein encoded by one or more of the following: MAP3K8 (TPL2 / COT), RAF1 (CRAF), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2), AXL (Axl), or PAK3 (Pak3). The combination therapy is suitable for treating a patient in which the cancer contains B-RAF mutant cells and in particular, B-RAF ^V600E mutant cells. The present invention further provides a combination therapy for cancer, which comprises an effective amount of an RAF inhibitor and an effective amount of a MEK inhibitor, wherein the individual with the cancer contains cells with the expression or the copy number MAP3K8 (TPL2 / COT) gene changes. In some embodiments, the MEK inhibitor is Cl1040 / PD184352 or AZD6244.
[0058] As a non-limiting example, the MEK inhibitor provided herein may be CI-1040, AZD6244, PD318088, PD98059, PD334581, RDEA119, 6-Methoxy-7- (3morfolin-4-yl-propoxy) -4- ( 4-phenoxy-phenylamino) -quinolin-3-carbonitrile or 4- [3-Chlorine-4
Petition 870190065596, of 07/12/2019, p. 27/131
22/120 (1-methyl-1 H-imidazol-2-ylsulfanyl) -phenylamino] -6-methoxy-7- (3-morpholin-4-yl-propoxy) quinoline-3-carbonitrile, Roche RG7420 compound, or combinations of these. Additional MEK inhibitors known in the art can also be used.
[0059] In exemplary embodiments of the following aspects, the RAF inhibitor provided here is PLX4720, PLX4032, BAY 43-9006 (Sorafenib), ZM 336372, RAF 265, AAL-881, LBT-613, or CJS352 (NVP- AAL881-NX (hereinafter referred to as AAL881) and NVP-LBT613-AG-8 (LBT613) are isoquinoline compounds (Novartis, Cambridge, MA). Exemplary additional RAF inhibitors useful for combination therapy include pan inhibitors -RAF, BRAF inhibitors, A-RAF inhibitors, and RAF-1 inhibitors In exemplary embodiments, RAF inhibitors useful for combination therapy include PLX4720, PLX4032, BAY 43-9006 (Sorafenib), ZM 336372 , RAF 265, AAL-881, LBT-613 and CJS352 Exemplary RAF inhibitors also include the compounds shown in PCT Publication No. WO / 2008/028141, the entire contents of which are incorporated herein by reference. examples additionally include the quinazolinone derivatives described in Publication PCT No. WO / 2006/024836, and the pyridinylquinazolinamine derivatives described in PCT Publication No. WO / 2008/020203, the entire contents of which are hereby incorporated by reference.
[0060] Administration of the combination includes administration of the combination in a single formulation or unit dosage form, administration of the individual agents of the combination concurrently but separately, or administration of the individual agents of the combination sequentially by any suitable route. Dosing the individual agents in the combination may require more frequent administration of one of the agents when compared to the other agent in the combination. Therefore, to allow proper dosing, packaged pharmaceutical products may contain one or more dosage forms that contain the combination of agents, and one or more dosage forms that contain one of the combinations of agents, but not the other agent (s) ( s) of the combination.
[0061] Agents may contain one or more asymmetric elements such as
Petition 870190065596, of 07/12/2019, p. 28/131
23/120 stereogenic centers or stereogenic axes, for example, asymmetric carbon atoms, so that the compounds can exist in different stereoisomeric forms. These compounds can be, for example, racemates or optically active forms. For compounds with two or more asymmetric elements, these compounds can additionally be mixtures of diastereomers. For compounds that have asymmetric centers, it should be understood that all of the optical isomers and their mixtures are covered. In addition, carbon-carbon double bonded compounds can occur in Z and E forms; All isomeric forms of the compounds are included in the present invention. In these situations, single enantiomers (optically active forms) can be obtained by asymmetric synthesis, synthesis of optically pure precursors, or by the resolution of racemates. The resolution of the racemates can also be carried out, for example, by conventional methods such as crystallization in the presence of a resolving agent, or chromatography, using, for example, a chiral HPLC column.
[0062] Unless otherwise specified, or clearly indicated by the text, reference to compounds useful in the combination therapy of the invention includes both the free base of the compounds and all pharmaceutically acceptable salts of the compounds. A preferred salt is the hydrochloride salt.
[0063] The term "pharmaceutically acceptable salts" includes derivatives of the disclosed compounds, in which the precursor compound is modified by making its non-toxic acid or base addition salts, and further refers to pharmaceutically acceptable solvates, which include hydrates, of such compounds and such salts. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid addition salts of basic residues such as amines; alkaline or organic addition salts of acid residues such as carboxylic acids; and the like, and combinations comprising one or more of the foregoing salts. Pharmaceutically acceptable salts include non-toxic salts and the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, acid salts do not
Petition 870190065596, of 07/12/2019, p. 29/131
Toxic 24/120 include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, and nitric; other acceptable inorganic salts include metal salts such as sodium salt, potassium salt, and cesium salt; and alkaline earth metal salts, such as calcium salt and magnesium salt; and combinations comprising one or more of the preceding salts.
[0064] Pharmaceutically acceptable organic salts include salts prepared from organic acids such as acetic, trifluoroacetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxyimalic, phenylacetic, glutamic, glutamic, glutamic, glutamic, glutamic, glutamic, glutamic, phenylacetic, glutamic. benzoic, salicylic, mesyl, esyl, besylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, disulfonic, oxalic, isethionic ethane, HOOC (CH2) nCOOH where n is 0 to 4; organic amine salts such as the triethylamine salt, pyridine salt, picoline salt, ethanolamine salt, triethanolamine salt, dicyclohexylamine salt, N, N'dibenzylethylenediamine salt; and amino acid salts such as arginate, asparginate, and glutamate, and combinations that comprise one or more of the preceding salts.
[0065] An "effective amount" of a combination of agents (for example, MEK and RAF inhibitors, or RAF and COT inhibitors, or RAF and an inhibitor targeting MAP3K8 (TPL2 / COT), RAF1 (CRAF), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2), AXL (Axl), or PAK3 (Pak3)) is sufficient to provide an observable improvement in relation to signs and symptoms clinically observable from the reference of the disorder treated with the combination.
[0066] Pharmaceutical products can be administered orally or in other ways, for example, rectally or by parenteral injection. The “oral dosage form” is intended to include a prescribed or intended unit dosage form for oral administration. An oral dosage form may or may not comprise a plurality of subunits such as, for example, microcapsules or microtablets, packaged for administration in a single dose.
[0067] Pharmaceutical products can be released in several ways. THE
Petition 870190065596, of 07/12/2019, p. 30/131
25/120 “Release form” is intended to include forms of instant release, immediate release, controlled release, and extended release.
[0068] The "instant release" is intended to include a dosage form designed to ensure rapid dissolution of the active agent by modifying the normal crystalline form of the active agent to obtain a faster dissolution.
[0069] "Immediate release" is intended to include a conventional or unmodified release form in which more than or equal to about 50% or more preferably about 75% of the active agents is released within two hours of administration , preferably within one hour of administration.
[0070] The "prolonged release" or "extended release" includes the release of active agents at such a rate that blood levels (eg plasma) are kept within a therapeutic range but below toxic levels for at least about 8 hours, preferably at least about 12 hours, more preferably about 24 hours after administration in the steady state. The term "steady state" means that a plasma level for a given active agent or combination of active agents has been reached and is maintained with subsequent doses of the active agent (s) at a level that is at or above the minimum effective therapeutic level and is below the minimum toxic plasma level for a given active agent (s).
[0071] The term "treat", "treated," "treating" or "treatment" is used here to mean mitigating, reducing or alleviating at least one symptom of a disease in an individual. For example, treatment may be the reduction of one or more symptoms of a disorder or complete eradication of a disorder, such as cancer. Within the meaning of the present invention, the term "treat" also denotes to halt, delay the onset (i.e., the period before the clinical manifestation of a disease) and / or reduce the risk of developing or worsening a disease. The term "protect" is used here to mean preventing, delaying or treating, or all, as appropriate, the development or continuation or worsening of a disease in an individual. Within the meaning of the present invention, the disease is associated with cancer.
Petition 870190065596, of 07/12/2019, p. 31/131
26/120 [0072] The term "individual" or "patient" is intended to include animals, which are capable of suffering from or afflicted with cancer or any disorder that involves, directly or indirectly, a cancer. Examples of individuals include mammals, for example, humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, mice, and transgenic non-human animals. In certain embodiments, the individual is a human being, for example, a human being suffering from, at risk of suffering from, or potentially capable of suffering from, cancers.
[0073] The term "about" or "approximately" as usual means within 20%, more preferably within 10%, and most preferably within 5% of a given value or range. Alternatively, especially in biological systems, the term "about" means within about a log (i.e., an order of magnitude) preferably within a factor of two of a given value.
[0074] The use of the terms "one" and "one" and "o" and "a" and similar referents in the context of describing the invention (especially in the context of the claims that follow) should be interpreted as covering both the singular and the plural, unless otherwise indicated here or clearly contradicted by the context. The terms "comprising," having, "" including, "and" containing "are to be interpreted as open-ended terms (that is, meaning" including, but not limited to ") unless otherwise mentioned. The reference to the ranges of values here is merely intended to serve as a summary method of referring individually to each separate value that falls within the range, unless otherwise indicated here, and each separate value is incorporated in the specification as if they were individually referred to here.
[0075] As specified above, in one aspect, the present invention provides a drug combination useful to treat, prevent, stop, delay the onset of and / or reduce the risk of developing, or reversing at least one symptom of cancer, in a individual comprising administering to the individual combination therapy, comprising an effective amount of an RAF inhibitor and an effective amount of a MAP3K8 inhibitor (TPL2 / COT), or an effective amount
Petition 870190065596, of 07/12/2019, p. 32/131
27/120 of an RAF inhibitor and an effective amount of MEK inhibitor or an effective amount of an RAF inhibitor and an effective amount of a second inhibitor targeting MAP3K8 (TPL2 / COT), RAF1 (CRAF), CRKL (CrkL ), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2), AXL (Axl), or PAK3 (Pak3). Preferably, these inhibitors are administered in therapeutically effective dosages which, when combined, provide a beneficial effect. Administration can be simultaneous or sequential.
[0076] The term "cancer" is used here to mean a broad spectrum of tumors, which includes all solid tumors and haematological malignancies. Examples of such tumors include but are not limited to leukemias, lymphomas, myelomas, carcinomas, metastatic carcinomas, sarcomas, adenomas, cancers of the nervous system and geritourinary cancers. In the exemplary embodiments, the foregoing methods are useful in adult and pediatric treatment acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancers, anal cancer, appendix cancer, astrocytoma, basal cell carcinoma, duct cancer gallbladder, bladder cancer, bone cancer, osteosarcoma, histiocytoma, brain cancer, brainstem glioma, cerebellar astrocytoma, malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumors, hypothalamic glioma, breast cancer, male breast cancer, bronchial adenomas Burkitt's disease, carcinoid tumor, carcinoma of unknown origin, lymphoma of the central nervous system, cerebellar astrocytoma, malignant glioma, cervical cancer, childhood cancers, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colorectal cancer, cutaneous T cell lymphoma cance r endometrial, ependymoma, esophageal cancer, tumors of the Ewing family, extracranial germ cell tumor, extragonadal germ cell tumor, extraepathic bile duct cancer, intraocular melanoma, retinoblastoma, gallbladder cancer, gastric cancer, gastrointestinal stromal tumor, tumor extracranial germ cell tumor, extragonadal germ cell tumor, ovahana germ cell tumor, gestational trophoblastic tumor, glioma, cell leukemia
Petition 870190065596, of 07/12/2019, p. 33/131
28/120 hair, head and neck cancer, hepatocellular cancer, Hodgkin's lymphoma, non-Hodgkin's lymphoma, hypopharyngeal cancer, hypothalamic and visual glioma, intraocular melanoma, islet cell tumors, Kaposi's sarcoma, kidney cancer, renal cell cancer, laryngeal cancer, lip and oral cavity cancer, small cell lung cancer, non-small cell lung cancer, primary central nervous system lymphoma, Waldenstrom macroglobulinemia, malignant fibrous histiocytoma, medulloblastoma, melanoma, cell carcinoma Merkel's disease, malignant mesothelioma, squamous neck cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis fungoides, myelo-dysplastic syndromes, myeloproliferative disorders, chronic myeloproliferative disorders, nasal cavity and paranasal bell cancer, nasopharyngeal cancer, neuroblastoma, neuroblastoma , ovarian cancer, pancreatic cancer, paratir cancer eoid, penile cancer, pharyngeal cancer, pheochromocytoma, pineoblastoma and primitive supratentorial neuroectodermal tumors, pituitary cancer, plasma cell neoplasms, pleuropulmonary blastoma, prostate cancer, rectal cancer, rhabdomyosarcoma, salivary gland cancer, uterine sarcoma, sarcoma of mole tissue Sezary's disease, non-melanoma skin cancer, small intestine cancer, squamous cell carcinoma, squamous neck cancer, primitive supratentorial neuroectodermal tumors, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer, trophoblastic tumors, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, and Wilms' tumors.
[0077] In particular, cancer may be associated with a mutation in the B-RAF gene. These cancers include melanoma, breast cancer, colorectal cancers, glioma, lung cancer, ovarian cancer, sarcoma and thyroid cancer.
[0078] In a particular embodiment, the therapeutic combination provided herein is effective for the treatment of moderate to severe cancer in an individual. [0079] Dosages [0080] The optimal dose of the combination of agents to treat cancer can be determined empirically for each individual using known methods and
Petition 870190065596, of 07/12/2019, p. 34/131
29/120 will depend on a variety of factors, including agent activity; the individual's age, body weight, general health, gender and diet; the time and route of administration; and other medications the individual is taking. Optimal Dosages can be established using routine testing and procedures that are well known in the art.
[0081] The amount of combination of agents that can be combined with the carrier materials to produce a single dosage form will vary depending on the individual treated and the particular mode of administration. In some embodiments, the unit dosage form containing the combination of agents as described herein will contain the amounts of each agent in the combination that are typically administered when the agents are administered alone.
[0082] A doctor or veterinarian who has common skill in the art can easily determine and prescribe the effective amount of the required pharmaceutical composition. For example, the doctor or veterinarian would initiate doses of the compounds of the invention used in the pharmaceutical composition at levels lower than that required in order to obtain the desired therapeutic effect and gradually increase the dosage until the desired effect is obtained.
[0083] In general, a suitable daily dose of a compound of the invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose in general will depend on the factors described above and is easily determined by a person skilled in the art.
[0084] In general, the therapeutically effective doses of the compounds of this invention to a patient, when used for the indicated analgesic effects, will vary from about 0.0001 to about 1000 mg per kilogram of body weight per day, more preferably about from 0.01 to about 50 mg per kg per day.
[0085] If desired, the effective daily dose of the active compound can be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in forms
Petition 870190065596, of 07/12/2019, p. 35/131
30/120 unit dosage.
[0086] Pharmaceutical Formulations and Routes of Administration [0087] Pharmaceutical formulations are provided here that comprise a combination of agents for the treatment of cancer, for example, melanoma. The pharmaceutical formulations can additionally comprise a carrier or excipient, stabilizer, flavoring agent, and / or coloring agent.
[0088] Pharmaceutical formulations are provided herein which comprise the combination of agents which may, for example, be a combination of two types of agents: (1) an RAF inhibitor and / or pharmacologically active metabolites, salts, solvates and racemates of the inhibitor and (2) a MAP3K8 inhibitor (TPL2 / COT) and / or pharmacologically active metabolites, salts, solvates and racemates of the COT inhibitor. In another embodiment the combination of agents can be provided to an individual comprising mutant BRAF cells or comprising cells that overexpress MAP3K8 (TPL2 / COT) and include: (1) an RAF inhibitor and / or metabolites, salts, pharmacologically active solvates and racemates of the inhibitor and (2) a MEK inhibitor and / or metabolites, salts, solvates and pharmacologically active racemates of the MEK inhibitor.
[0089] The combination of agents can be administered using a variety of routes of administration known to those skilled in the art. The combination of agents can be administered to humans and other animals orally, parenterally, sublingually, by aerosolization or inhalation spray, rectal, intracisternal, intravaginal, intraperitoneal, buccal, or topically in unit dosage formulations containing carriers, adjuvants, and vehicles conventional non-toxic pharmaceutically acceptable as desired. Topical administration may also involve the use of transdermal administration such as transdermal patch or ionophoresis devices. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular injections, intrasternal injection, or infusion techniques.
[0090] Formulation methods are well known in the art and are disclosed, for example, in Remington: The Science and Practice of Pharmacy,
Petition 870190065596, of 07/12/2019, p. 36/131
1/31
Mack Publishing Company, Easton, Pa., 19th Edition (1995). The pharmaceutical compositions for use in the present invention can be in the form of sterile, non-pyrogenic liquid solutions or suspensions, coated capsules, suppositories, lyophilized powders, transdermal patches or other forms known in the art. [0091] Injectable preparations, for example, sterile injectable aqueous or oil suspensions can be formulated according to the known technique using suitable dispersing or wetting agents. The sterile injectable preparation can also be a sterile injectable solution, suspension or emulsion in a non-toxic parenterally acceptable diluent or solvent, for example, as a solution in 1.3 propanediol or 1.3 butanediol. Among the acceptable vehicles and solvents that can be used are water, Ringer's solution, USP and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally used as a solvent or suspending medium. For this purpose any soft fixed oil can be used which includes synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. Injectable formulations can be sterilized, for example, by filtration through a bacterial retention filter, or by the incorporation of sterilizing agents in the form of sterile solid compositions that can be dissolved or dispersed in sterile water or other sterile injectable medium before use.
[0092] In order to prolong the effect of a medicine, it is often desirable to decrease the absorption of the medicine by subcutaneous or intramuscular injection. This can be accomplished by using a liquid suspension of crystalline or amorphous material with insufficient water solubility. The rate of absorption of the drug then depends on its rate of dissolution which, in turn, may depend on the size of the crystal and crystalline shape. Alternatively, delayed absorption of a parenterally administered drug form can be accomplished by dissolving or suspending the drug in an oily vehicle. Injectable deposit forms are manufactured by forming matrices of microencapsulation of the drug in biodegradable polymers such as
Petition 870190065596, of 07/12/2019, p. 37/131
32/120 polylactide polyglycolide. Depending on the drug to polymer ratio and the nature of the particular polymer used, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly (orthoesters) and poly (anhydrides). Injectable depot formulations can also be prepared by trapping the drug in liposomes or microemulsions, which are compatible with body tissues.
[0093] Compositions for rectal or vaginal administration are preferably suppositories that can be prepared by mixing the compounds of this invention with suitable non-irritating excipients or carriers such as cocoa butter, polyethylene glycol or a suppository wax that are solid at temperature environment but liquids at body temperature and therefore fuse in the rectum or vaginal cavity and release the active compound.
[0094] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active compound is mixed with at least one pharmaceutically acceptable inert excipient or carrier such as sodium citrate or dicalcium phosphate and / or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binder such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) wetting agents such as glycerol, d) disintegrating agents such as agar, calcium carbonate, starch potato or tapioca, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, acetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, ei) lubricants such as talc, calcium stearate, magnesium stearate, polyethylene gl solid icons, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form can also comprise buffering agents.
[0095] Solid compositions of a similar type can also be used as fillers in soft or hard filled gelatin capsules using
Petition 870190065596, of 07/12/2019, p. 38/131
33/120 excipients such as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
[0096] Solid dosage forms of tablets, pills, capsules, pills, and granules can be prepared with coatings and peels such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They may optionally contain opacifying agents and may also be of a composition that they release only the active ingredient (s), or preferably, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of inlay compositions that can be used include polymeric substances and waxes.
[0097] The active compounds can also be in micro-encapsulated form with one or more excipients as mentioned above. The solid dosage forms of tablets, pills, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release control coatings and other coatings well known in the pharmaceutical formulation art. In such solid dosage forms the active compound can be mixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, for example, tablet lubricants and other tabletting auxiliaries such as magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets and pills, the dosage forms can also comprise buffering agents. They can optionally contain opacifying agents and can also be of a composition that releases only the active ingredient (s), or preferably, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of inlay compositions that can be used include polymeric substances and waxes.
[0098] Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the additional active compounds, forms of
Petition 870190065596, of 07/12/2019, p. 39/131
34/120 liquid dosages may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, EtOAc, benzyl alcohol, benzyl benzoate, propylene glycol, 1.3 butylene glycol, dimethylformamide, oils (in particular, cottonseed oils, peanuts, corn, germ, olive, castor and sesame), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and sorbitan fatty acid esters mixtures of these. In addition to inert diluents, oral compositions can also include adjuvants such as wetting agents, emulsifiers and suspending agents, sweeteners, flavorings and perfuming agents.
[0099] Dosage forms for topical or transdermal administration of a compound of this invention include ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants or plasters. The active component is administered under sterile conditions with a pharmaceutically acceptable carrier and any necessary preservatives or buffers as may be required. Ophthalmic formulations, ear drops and the like are also considered to be within the scope of this invention.
[00100] Ointments, pastes, creams and gels may contain, in addition to an active compound of this invention, excipients such as animal and vegetable fats, oils, waxes, paraffins, starch, bring corner, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acids, talc and zinc oxide, or mixtures thereof.
[00101] The compositions of the invention can also be formulated for delivery as a liquid aerosol or inhalable dry powder. Liquid aerosol formulations can be nebulized predominantly in particle sizes that can be released from terminal and respiratory bronchioles.
[00102] The aerosolized formulations of the invention can be released using an aerosol-forming device, such as a jet, vibrating porous plate or ultrasonic nebulizer, preferably selected to allow the formation of aerosol particles that have a predominantly average diameter 1 to 5 pm. In addition, the formulation preferably has osmolarity, ionic strength and
Petition 870190065596, of 07/12/2019, p. 40/131
35/120 chloride concentration and the smallest aerosolizable volume capable of delivering an effective dose of the compounds of the invention to the infection site. In addition, the aerosolized formulation preferably does not negatively impair airway functionality and does not cause undesirable side effects.
[00103] Aerosolization devices suitable for administering the aerosol formulations of the invention include, for example, jet, vibrating porous plate, ultrasonic nebulizer and energized dry powder sprayers, which are capable of nebulizing the formulation of the invention at particle size aerosol spray predominantly in the 1 to 5 pm size range. Predominantly in these means of application at least 70% but preferably more than 90% of all generated aerosol particles are within the range of 1 to 5 pm. A jet nebulizer works by air pressure to break a liquid solution into aerosol droplets. Vibrating porous plate nebulizers work by using a sonic vacuum produced by a rapidly vibrating porous plate to extrude a droplet of solvent through a porous plate. An ultrasonic nebulizer works by means of a piezoelectric crystal that shifts a liquid into small aerosol droplets. A variety of suitable devices are available, which include, for example, the AERONEB and AERODOSE vibrating porous plate nebulizers (AeroGen, Inc., Sunnyvale, California), the SIDESTREAM nebulizers (Medie Aid Ltd., West Sussex, England), the jade nebulizers PARI LC and PARI LC STAR (Pari Respiratory Equipment, Inc., Richmond, Virginia) and AEROSONIC (DeVilbiss Medizinische Produkte (Deutschland) GmbH, Heiden, Germany) and ULTRAAIRE (Omron Healthcare, Inc., Vernon Hills, lllinois) ultrasonic nebulizers.
[00104] The compounds of the invention can also be formulated for use as topical powders and sprays that may contain, in addition to the compounds of this invention, excipients such as lactose, talc, silicic acids, aluminum hydroxide, calcium silicates and polyamide powder , or mixtures of these substances. The sprays can additionally contain the usual propellants such as chlorofluorohydrocarbons.
Petition 870190065596, of 07/12/2019, p. 41/131
36/120 [00105] Transdermal patches have the additional advantage of providing controlled release of a compound to the body. Such dosage forms can be manufactured by dissolving or dispensing the compound in the appropriate medium. Absorption enhancers can also be used to increase the flow of the compound through the skin. The rate can be controlled by providing a rate-controlling membrane or by dispersing the compound in a polymeric matrix or gel. The compounds of the present invention can also be administered in the form of liposomes. As is known in the art, liposomes are generally derived from phospholipids or other lipid substances. Liposomes are formed by hydrated mono- or multi-lamellar liquid crystals that are dispersed in an aqueous medium. Any non-toxic, physiologically acceptable and metabolizable lipid capable of forming liposomes can be used. The present compositions in the form of liposomes may contain, in addition to a compound of the present invention, stabilizers, preservatives, excipients and the like. The preferred lipids are phospholipids and phosphatidyl choline (lecithins), both natural and synthetic. Methods for forming liposomes are known in the art. See, for example, Prescott (ed)., “Methods in Cell Biology,” Volume XIV, Academic Press, New York, 1976, p. 33 et seq.
[00106] Examples [00107] Example 1: A functional screening based on ORF identifies specific kinases as controllers of resistance to B-RAF inhibition.
[00108] To identify kinases capable of circumventing RAF inhibition, 597 kinase ORF clones validated in the sequence representing ~ 75% of the annotated kinases (Center for Cancer Systems Biology (CCSB) ZBroad Institute Kinase ORF Collection) were assembled and stably expressed in A375 cells, a line of malignant melanoma ^V600E BdRAF cell that is sensitive to inhibitor of RAF kinase PLX4720 (Tsai, J. et al. , Proc. Natl Acad. Sci. USA 105, 3041-3046 (2008)) (Figure 1a, 1b, Table 3, Fig. 6c). Cells expressing ORF treated with 1 μΜ of PLX4720 were screened for viability relative to untreated and normalized cells for a specific positive assay control,
Petition 870190065596, of 07/12/2019, p. 42/131
37/120 _MEK1 S218 / 222D _(MEK1 DD) ( _{Emery CM} . _{Et a} | p _roc . _Na tl _Aca d. _Sc j. _USA 106, 2041120416 (2009)). (Table 4 and summarized in Fig. 5). Nine ORFs provided resistance to levels exceeding two standard deviations from the mean (Fig. 1b and Table 4) and were selected for further analysis (Fig. 7). Three out of nine candidate ORFs were receptor tyrosine kinases, highlighting the potential of this class of kinases to engage resistance pathways. The effects of resistance were validated and prioritized by a PLX4720 drug concentration in the range of multipoint BdRAF ^V600E cell lines A375 and SKMEL28. The Ser / Thr MAP kinase kinase kinases (MAP3Ks) MAP3K8 (COT / Tpl2) and RAF1 (CDRAF) emerged as top candidates for both cell lines; these ORFs changed the Gho of PLX4720 10 to 600 times without affecting viability (Table 5 and Figs. 8 and 9). CRKL, an ORF that changed Gho from PLX4720 to a lesser degree (9.7 times in SKMEL28 cells; Fig. 8), encodes an adapter protein phosphorylated by tyrosine kinases such as BCR-ABL (Birge, RB et al., Cell Commun Signal 7, 13 (2009)), but lacks intrinsic kinase activity. CdRAF TOC and reduced sensitivity to PLX4720 in BdRAF ^V600E multiple cell lines (Fig. 1C) confirming the ability of these kinases mediate resistance to inhibition of RAF. A secondary screening on A375 and SKMEL28 prioritizes the 9 top candidate ORFs using a multi-point PLX4720 concentration scale (Fig. 1 d).
[00109] Interestingly, the two top validated kinases are both Ser / Thr MAP kinase kinase kinases (MAP3Ks) known to activate MEK / ERK signaling in various contexts. Like B-RAF, C-RAF is a MAP3K in the canonical MAPK cascade (McKay, Μ. M. and Morrison, DK Oncogene 26, 3113D3121 (2007)) that was previously implicated in the resistance associated with staggered in vitro selection using a pan-RAF inhibitor (Montagut, C. et al. Cancer Res 68, 4853-4861 (2008)). COT (the protein product of the human MAP3K8 gene) is best characterized as MAP3K (Salmeron, A. et al. EMBO J 15, 817D826 (1996)) downstream of NFKB signaling in inflammatory cells (Banerjee, A. et al ., Proc Natl Acad Sci USA 103, 3274D3279 (2006)); however, its importance
Petition 870190065596, of 07/12/2019, p. 43/131
38/120 function in human cancer has not been elucidated previously.
[00110] Example 2: Resistance to B-RAF inhibition through activation of the MAPK path.
[00111] Whether the overexpression of these genes was sufficient to activate the MAPK pathway was also tested. At baseline, COT expression increased ERK phosphorylation in a manner comparable to MEK1 ^DD , compatible with MAP kinase pathway activation (Figs. 2a and 10). Overexpression of wild-type COT or CdRAF resulted in constitutive phosphorylation of ERK and MEK in the presence of PLX4720, whereas dead kinase derivatives had no effect (Figs. 2a and 11). Thus, COT and CdRAF induce resistance to RAF inhibition predominantly through the re-activation of MAPK signaling. Notably, of the nine candidate ORFs from the initial screening, a subset (3) did not show persistent ERK / MEK phosphorylation following RAF inhibition, suggesting that the MAPK path-independent change in drug sensitivity (Figure 12).
[00112] Example 3: Activation and heterodimerization of C-RAF with B-RAF.
[00113] Activation and heterodimerization of CdRAF with BdRAF are critical components of the cellular response to BDRAF inhibition. In A375 cells, endogenous CdRAF: BDRAF heterodimers were measurable and inducible following treatment with PLX4720 (Fig. 13). However, phosphorylation of endogenous CdRAF in S338 - an event required for CdRAF activation - remained low (Fig. 13). In contrast, ectopically expressed CdRAF was phosphorylated in S338 (Fig. 13) and its PLX4720 resistance phenotype was associated with prolonged MEK / ERK activation (Figs. 2a and 13). In addition, the ectopic expression of a highly active CdRAF truncation mutant (CdRAF (W22) was more effective than wild-type CdRAF in mediating resistance to PLX4720 and activating ERK (Fig. 14), further indicating that the high CdRAF activity directs resistance to this agent Compatible with this model, the oncogenic alleles of NRAS and KRAS conferred resistance to PLX4720 in A375 cells (Fig. 2b) and produced CdRAF (S338) and prolonged ERK phosphorylation in the context of drug treatment
Petition 870190065596, of 07/12/2019, p. 44/131
39/120 (Fig. 2c). Thus, although the genetic changes that engender the activation of Cd RAF (for example, oncogenic RAS mutations) tend to be mutually exclusive with the BdRAF V600E ^mutation , such events that occur together are favored in the context of acquired resistance to BDRAF inhibition. .
[00114] Example 4: Investigation of TOC expression in Melanoma [00115] While C-RAF was previously linked to melanoma and MAPK path dependencies (Montagut, C. et al. 2008; Karreth, FA, DeNicola, GM et al ., 2009; Dumaz, N. et al. Cancer Res 66, 9483D9491 (2006); Hatzivassiliou, G. et al. Nature (2010); Heidorn, SJ et al., Cell 140, 209-221 (2010); Poulikakos , PI et al., Nature (2010)), TOC has not been described as a melanoma-associated kinase.
[00116] The role of TOC in melanoma has been investigated and its expression in human melanocytes has been examined. The primary immortalized melanocytes (wild-type BDRAF) expressed COT (Fig. 2d), although ectopic BRAF ^V600E expression reduced COT mRNA levels (Fig. 15) and rendered the COT protein undetectable (Fig. 2d) . Instead, whereas TOC expressed ectopically was only weakly detectable in A375 cells (Fig. 2a, 2e), mediated by endogenous ^V600E BdRAF shRNA depletion caused an increase in the TOC levels of protein that are correlated with the degree of silencing of BDRAF (Fig. 2e). In addition, treatment of A375 cells expressing COT with PLX4720 led to a dose-dependent increase in COT protein (Fig. 2a) without affecting ectopic COT mRNA levels (Fig. 15). Oncogenic BDRAF antagonizes COT expression largely through altered protein stability (Figs. 2a, d, and 15) and inhibiting BDRAF potentiating the outbreak of cells that express COT during the course of treatment. Notably, neither CdRAF nor BDRAF alone or in combination was required for phosphorylation of ERK in the context of COT expression, even in the presence of PLX4720 (Figs. 2e, 2f and Fig. 16). As shown, the expression of COT is sufficient to induce the activation of the MAP kinase pathway in an RAF-independent manner.
Petition 870190065596, of 07/12/2019, p. 45/131
40/120 [00117] Example 5: TOC expression predicts resistance to B-RAF inhibition in cancer cell lines.
[00118] If the cell lines expressing high TOC on a background display BdRAF ^V600E new resistance to treatment with PLX4720 was tested. To identify such cases, a panel of cell lines was screened for evidence of MAP3K8 / COT copy number gains coinciding with the BdRAF V600E ^mutation . Of the 534 cell lines that underwent copy number analysis and definition of mutation profiles, 38 cell lines (7.1%) contained the BdRAF V600E ^mutation . Within this subgroup, two cell lines - OUMSD23 (colonic cancer) and RPMID7951 (melanoma) - also showed evidence of chromosome copy gains that span the MAP3K8 / COT site (Figs. 3a and 17) and robust COT protein expression (Figs. 3b and 18). A panel of short-lived melanoma cultures was also screened for COT protein expression. One of these strains expressed COT: M307, a short-lived culture derived from a B-RAF ^V600E tumor that developed resistance to allosteric MEK inhibition following initial disease stabilization (Fig. 3c). All three cell lines were refractory to treatment with PLX4720, exhibiting Gho values in the range of 8 to 10 μΜ (Fig. 3d) and showing prolonged ERK phosphorylation in the context of BdRAF inhibition (Figs. 3e, 3f). OUMSD23 and RPMID7951 are naive cell lines for MAPK pathway inhibitor; Thus, these results demonstrate that new TOC confers resistance to inhibition of RAF (a phenomenon observed in ~ 10% of melanomas BdRAF ^V600E).
[00119] Example 6: TOC expression in patients treated with an RAF inhibitor.
[00120] The TOC expression in the context of clinical resistance to RAF inhibitor PLX4032 was examined by obtaining biopsy specimens of 3 patients with metastatic melanoma ^V600E BdRAF. Each case consisted of frozen biopsy material, matched by a lesion obtained before and during treatment (“pre □ treatment” and “during treatment”; Fig. 3g, Table 6); additionally, a sample contained two
Petition 870190065596, of 07/12/2019, p. 46/131
41/120 biopsy specimens independent of the same tumor site in relapse (“postDrecaída”; Fig. 3g). Compatible with the experimental models presented above, quantitative real-time RTDPCR (qRT / PCR) analysis revealed expression of the increased COT mRNA concurrent with treatment with PLX4032 in 2 of 3 cases. The levels of TOC mRNA were further increased in a relapse specimen in relation to its pretreatment counterparts and during treatment (Fig. 3g, Patient # 1). A biopsy of malignant melanoma in the additional, unpaired relapse showed expression of elevated TOC mRNA comparable to the levels observed in cell lines resistant to the RAF inhibitor, amplified in TOC (Fig. 19). This specimen also showed activation of the MAPK pathway robust expression of high BdRAF, Cd RAF and TOC in relation to skin cell lines or paired normal BdRAF ^V600E (Fig. 19). Sequencing studies of this tumor did not reveal any of the additional mutations in BRAF, NRAS or KRAS (data not shown). These analyzes provided clinical evidence that the TOC-dependent mechanisms are operative in PLX4032-resistant malignant melanomas.
[00121] Example 7: COT regulation of MEK / ERK phosphorylation.
[00122] If TOC actively regulates the phosphorylation of MEK / ERK in BdRAF ^V600E cells harboring the naturally high expression of TOC was tested by the introduction of shRNA constructs targeting COT RPMID7951 cells. The depletion of TOC suppressed the viability of RPMID7951 (Fig. 20) and decreased the phosphorylation of ERK (Fig. 3h); thus, targeting COT kinase activity suppresses MEK / ERK phosphorylation in cancer cells with overexpression or amplification of COT. In addition, the bleaching COT kinase activity in the presence of a B-RAF inhibitor (PLX4720) suppresses MEK / IRK phosphorylation (Fig. 3h). Treatment of RPMID7951 cells with a small molecule COT kinase inhibitor (Wyeth, Abbot compound ID 9549300) (George, D. et al., Bioorg. Med. Chem. Lett, 18, 4952-4955 (2008); Hirata , K. et al., Biol. Pharm. Bull, 33, 133137 (2010); Lee, KM et al., Cancer Res, 69, 8043-8049 (2009)) resulted in dose-dependent suppression of MEK phosphorylation and ERK, providing
Petition 870190065596, of 07/12/2019, p. 47/131
42/120 additional evidence that TOC contributes to the activation of MEK / ERK in these cells (Fig. 3i).
[00123] Example 8: B-RAF ^V600E cell lines expressing COT exhibit resistance to allosteric MEK inhibitors.
[00124] Whether cancer cells expressing COT remain sensitive to inhibition of the MAPK pathway in a target downstream of COT or RAF has been analyzed. Cell lines OUMSD23 and RPMID7951 were examined for sensitivity to the MEK1 / 2 inhibitor CID1040. Both cell lines were refractory to MEK inhibition (Fig. 4a) and demonstrated prolonged ERK phosphorylation even at 1 μΜ of CID1040 (Fig. 4b). ectopic TOC expression in A375 and SKMEL28 cells also conferred decreased sensitivity to MEK Cl □ 1040 and AZD6244 inhibitors, suggesting that TOC expression alone was sufficient to induce this phenotype (Figs. 4c, 4d and 21). Similar to the results observed with pharmacological MEK inhibitors, silencing MEK1 / 2 only modestly suppressed COT-mediated ERK phosphorylation in A375 cells (Fig. 22). These data demonstrate that COT activates ERK through MEK-independent and MEK-dependent mechanisms. In addition, an in vitro kinase assay using recombinant COT and ERK1 was performed and it was shown that recombinant COT induced ERK1 pThr202 / Tyr204 phosphorylation in vitro (Fig. 22). Thus, the expression of COT potentiates the activation of ERK in a way independent of MEK.
[00125] Example 9: Combinatorial inhibition of the pathway to suppress cell proliferation.
[00126] The use of RAF and MEK inhibitors in combination can overcome the resistance to the agents alone as shown in Fig 23. It was tested whether the combined RAF / MEK inhibition would elude COT-induced resistance. In the ectopic TOC expression scenario, exposure to AZD6244 or CID1040 in combination with PLX470 (1 μΜ each) reduced cell growth and pERK expression more effectively than did the PLX4720 agent alone, even at concentrations of 10 μΜ (Figs. 4e, 4f and 23). These data highlight the
Petition 870190065596, of 07/12/2019, p. 48/131
43/120 importance in this way BdRAF ^V600E tumor cells and demonstrates that inhibition BDRAF / MEK dual helps trick resistance to RAF inhibitors.
[00127] Methods [00128] ZBroad Institute Kinase Center for Cancer Systems Biology (CCSB) Open Reading Matrix Collection [00129] A library of 597 kinase ORFs in input vectors pDONR-223 (Invitrogen) was assembled. The individual clones were sequenced at the end using specific vector primers in both directions. Clones with substantial deviations from the reported sequences were discarded. The clones and input sequences are available through Addgene (http://www.addgene.org/ human_cinases). The kinase ORFs were assembled from multiple sources; 337 kinases were isolated as single clones from the ORFeome 5.1 collection (http://horfdb.dfci.harvard.edu), 183 kinases were cloned from normal human tissue RNA (Ambion) by reverse transcription and amplification by subsequent PCR to add the Gateway sequences (Invitrogen), 64 kinases were cloned from standards provided by the Harvard Institute of Proteomics (HIP) and 13 kinases were cloned into the Gateway system from standards obtained from collaborating laboratories. The Gateway-compatible lentiviral vector pLX-Blast-V5 was created from the pLKO.1 backbone. Enzymatic recombination reactions with LR Clonase were performed to introduce the 597 kinases into pLX-Blast-V5 according to the manufacturer's protocol (Invitrogen).
[00130] High Yield ORF Screening [00131] A375 melanoma cells were plated on microtiter plates of 384 wells (500 cells per well). The next day, the cells were spin-infected with the ORF library of the lentiviral kinase packaged in the presence of 8 pg / ml polybrene. 48 hours after infection, the media were replaced with standard growth media (2 replicates), media containing 1 μΜ PLX4720 (2 replicates, 2 time points) or media containing 10 pg / ml blasticidine (2 replicates). After four days and 6 days, cell growth was assayed using Cell TiterDGIo (Promega) according to the manufacturer's instructions. O
Petition 870190065596, of 07/12/2019, p. 49/131
44/120 entire experiment was performed twice.
[00132] Identification of candidate resistance ORFs [00133] The gross luminescence values were imported into Microsoft Excel. Infection efficiency was determined by the percentage of gross luminescence averaged from the duplicate in selected cells on blasticidine in relation to the unselected cells. ORFs with an infection efficiency of less than 0.70 were excluded from another analysis along with any ORF that had a standard deviation of> 15,000 units of gross luminescence between duplicates. To identify ORFs whose expression would affect proliferation, we compared the gross luminescence averaged from the duplicate of individual ORFs against the mean and standard deviation of all cells treated with control by means of the z count, or standard count, below, the
where x = mean gross luminescence of a given ORF, μ = the mean gross luminescence of all ORFs and o = the standard deviation of the gross luminescence of all reservoirs. Any individual ORF with a z count of> +2 or <D2 was noted to affect proliferation and removed from the final analysis. Differential proliferation was determined by the percentage of gross luminescence values averaged from the duplicate in cells treated with PLX4720 (1 μΜ) compared to untreated cells. Subsequently, differential proliferation was normalized to the positive control for resistance to PLX4720, MEK1 ^{S218 / 222D} (MEK1 ^DD ), with differential proliferation of MEK1 ^DD = 1.0. The normalized differential proliferation of MEK1 ^DD for each individual ORF was averaged over two duplicate experiments, with two time points for each experiment (day 4 and day 6). A z count was then generated, as described above for the MEK1 ^DD average normalized differential proliferation. ORFs with a z count of> 2 were considered correct and were followed up on secondary screening.
[00134] ORF and shRNA expression
Petition 870190065596, of 07/12/2019, p. 50/131
45/120 [00135] ORFs were expressed from pLXDBIastDV5 (lentiviral) or pWZLDBIast, pBABEDPuro or pBABEDzeocin (retroviral) expression plasmids. For lentiviral transduction, 293T cells were transfected with 1 pg of pLXDBIastDV5DORF or pLKO, 1 DshRNA, 900 ng Δ8.9 (gag, pol) and 100 ng VSVDG using 6 pl of Fugene6 transfection reagent (Roche). The viral supernatant was collected 72 h after transfection. Mammalian cells were infected at a 1: 10d1: 20 dilution of virus in 6 well plates in the presence of 5 pg / ml polybrene and centrifuged at 2250 RPM for 1 h at 37 ° C. Twenty-four hours after blasticidin infection (pLXDBIastDV5, 10 pg / ml) or pure (pLKO, 1, 0.75 pg / ml) were added and the cells were selected for 48 hours. For retrovirus production, 293T were transfected with 1 pg of DORF retroviral plasmid, 1 pg of pCLDAMPHO and 100 ng of VSVDG, as described above. The cells were infected with a supernatant containing retrovirus in a 1: 2 dilution in 5 pg / ml of polybrene overnight, followed by the change in the medium to growth medium. The infection was repeated once more (total twice), followed by the selection above.
[00136] Secondary Screening [00137] A375 (1.5 x 10 ³ ) and SKMEL28 (3 x 10 ³ ) cells were seeded in 96 well plates for 18 h. the ORF-expressing lentivirus was added to a 1:10 dilution in the presence of 8 pg / ml polybrene and centrifuged at 2250 RPM and 37 ° C for 1 h. Following centrifugation, the medium containing the virus was changed to normal growth medium and allowed to incubate for 18 h. Twenty-four hours after infection, DMSO (1: 1000) or 10x PLX4720 (in DMSO) was added to a final concentration of 100, 10, 1, 0.1, 0.01, 0.001, 0.0001 or 0, 00001 μΜ. Cell viability was tested using WSTD1 (Roche), according to the manufacturer's recommendation, 4 days after adding PLX4720.
[00138] Cell lines and reagents [00139] A375, SKMEL28, SKMEL30, COLOD679, WM451lu, SKMEL5, Malme 3M, SKMEL30, WM3627, WM1976, WM3163, WM3130, WM3629, WM3453, WM3682 and WM3682 ), 10% FBS and 1% penicillin /
Petition 870190065596, of 07/12/2019, p. 51/131
46/120 streptomycin. M307 was grown in RPMI (Cellgro), 10% FBS and 1% penicillin / streptomycin supplemented with 1 mM sodium pyruvate. 293T and OUMSD23 were grown in DMEM (Cellgro), 10% FBS and 1% penicillin / streptomycin. RPMID7951 cells (ATCC) were cultured in MEM (Cellgro), 10% FBS and 1% penicillin / streptomycin. Primary wild-type melanocytes were cultured in HAM's F10 (Cellgro), 10% FBS and 1% penicillin / streptomycin. The primary melanocytes expressing BdRAF ^V600E were cultured in TIVA [Ham's FD10 (Cellgro), 7% FBS, 1% penicillin / streptomycin, 2 mM glutamine (Cellgro), 100 μΜ IBMX, 50 ng / ml TPA , 1 mM dbcAMP (Sigma) and 1 μΜ sodium vanadate], Cl □ 1040 (PubChem ID: 6918454) was acquired from Shanghai Lechen International Trading Co., AZD6244 (PubChem ID: 10127622) from Selleck Chemicals and PLX4720 (PubChem ID: 24180719) from Symansis. RAF265 (PubChem ID: 11656518) was a generous gift from NovartisPharma AG. Unless otherwise indicated, all drug treatments were for 16 h. The activated NRAS and KRAS alleles have been previously described.
[00140] (Boehm, J. S. et al. Cell 129, 1065-1079 (2007); Lundberg, A. S. et al. Oncogene 21,4577-4586 (2002)).
[00141] Pharmacological growth inhibition assays [00142] Cultured cells were seeded in 96 well plates (3,000 cells per well) for all melanoma cell lines; 1,500 cells were seeded for A375. Twenty-four hours after sowing, serial dilutions of the relevant compound were prepared in DMSO added to the cells, producing final drug concentrations ranging from 100 μΜ to 1 x 10 ⁵ μΜ, with the final volume of DMSO not exceeding 1%. The cells were incubated for 96 hours following the addition of medication. Cell viability was measured using the WST1 viability assay (Roche). Viability was calculated as a percentage of the control (untreated cells) after subtraction from the bottom. A minimum of six replicates were performed for each cell line and drug combination. The data from the growth inhibition assays were modeled using a
Petition 870190065596, of 07/12/2019, p. 52/131
47/120 non-linear regression curve with a sigmoid dose-response. These curves were demonstrated and Glso generated using GraphPad Prism 5 for Windows (GraphPad). Sigmoid response curves that crossed the 50% inhibition point at or above 10 μΜ have Gho values noted as> 10 μΜ. For single dose studies, the identical protocol was followed, using a single dose of the indicated drug (1 pM unless otherwise mentioned).
[00143] Immunoblots and immunoprecipitations [00144] The cells were washed twice with ice-cold PBS and lysed with 1% NPD40 buffer [150 mM NaCI, 50 mM Tris pH 7.5, 2 mM EDTA pH 8, 25 mM NaF and 1% NPD40] containing 2x protease inhibitors (Roche) and 1x Phosphatase Inhibitor Cocktails I and II (CalBioChem). Lysates were quantified (Bradford assay), normalized, reduced, denatured (95 ° C) and resolved by SDS gel electrophoresis in 10% Tris / Glycine gels (Invitrogen). The protein was transferred to PVDF membranes and probed with primary antibodies that recognize pERK1 / 2 (T202 / Y204), pMEK1 / 2 (S217 / 221), MEK1 / 2, MEK1, MEK2, CDRAF (rabbit host), pCDRAF (pS338 ) (Cell Signaling Technology; 1: 1,000), V5DHRP (Invitrogen; (1: 5,000), COT (1: 500), BDRAF (1: 2,000), Actin (1: 1,000), ActinaDHRP (1: 1,000; Santa Cruz )), CDRAF (mouse host; 1: 1,000; BD Transduction Labs), Vinculin (Sigma; 1: 20,000), AXL (1: 500; R&D Systems). After incubation with the appropriate secondary antibody (anti-rabbit IgG, anti-mouse, HRP-linked; 1: 1,000 dilution, Cell Signaling Technology or HRP-linked IgG; 1: 1,000 dilution; Santa Cruz), the proteins were detected using chemiluminescence ( Pierce). The immunoprecipitations were performed overnight at 4 ° C in 1% NPD40 lysis buffer as described above at a concentration of 1 pg / pl total protein using an antibody which recognizes CDRAF (1:50; Cell Signaling Technology) . Antibody: antigen complexes were bound to Protein A agarose (25 uL, 50% slurry; Pierce) for 2 hours at 4 C. The beads were centrifuged and washed three times in lysis buffer , and eluted and denatured (95 ° C) in 2x reduced sample buffer (Invitrogen). Immunoblots were
Petition 870190065596, of 07/12/2019, p. 53/131
48/120 carried out as above. Quantification of phosphoDprotein was performed using NIH Image J.
[00145] Tumor lysates and normal skin matched were generated by mechanical tissue homogenization in RIPA [50 mM Tris (pH 7.4), 150 mM NaCI, 1 mM EDTA, 0.1% SDS, 1 , 0% NaDOC, 1.0% Triton XD100, 25 mM NaF, 1 mM Na3VO4] containing protease and phosphatase inhibitors, as above. Normalization and subsequent immunoblots were performed as above.
[00146] Melanoma tumor material submitted to biopsy [00147] The tumor material submitted to biopsy consisted of discarded and deidentified tissue that was obtained with informed consent and characterized under protocol 02D017 (paired samples, Massachusetts General Hospital) and 07D087 ( unpaired sample, DanaDFarber Cancer Institute). For paired specimens, samples 'in treatment' were collected 10 to 14 days after starting treatment with PLX4032 (Table 6).
[00148] Inhibition of COT kinase activity [00149] RPMID7951 adherent cells were washed twice with 1x PBS and incubated overnight in serum-free growth medium. Subsequently, 4D (3DCIoroD4Dfluorophenylamino) -6D (pyridinD3Dylmethylamino) 3DcianoD [1,7] □ naphthyridine (EMD; TPL2 inhibitor I; Cat #: 616373, PubChem ID: 9549300), suspended in DMSO at the indicated concentration, was added to the cells for 1 hour, after the protein extracts were made as described above.
[00150] Quantitative RT-PCR [00151] The mRNA was extracted from cell lines and fresh frozen tumors using the RNeasy kit (Qiagen). The total mRNA was used for subsequent reverse transcription using the SuperScript III FirstDStrand Synthesis SuperMix (Invitrogen) for cell lines and unpaired tumor samples and the SuperScript VILO cDNA (Invitrogen) synthesis kit for the paired frozen tumor samples. 5 pl of the RT reaction was used for quantitative PCR using SYBR Green PCR Master
Petition 870190065596, of 07/12/2019, p. 54/131
49/120
Mix and specific gene primers, in triplicate, using an ABI 7300 Real Time PCR
System. The primers used for detection are as follows:
Initiator Sequence SEQ. ID. AT THE. Advanced COT CAAGTGAAGAGCCAGCAGTTT SEQ. ID. NO: 1 Reverse COT GCAAGCAAATCCTCCACAGTTC SEQ. ID. NO: 2 Advanced TBP CCCGAAACGCCGAATATAATCC SEQ. ID. NO: 3 Reverse TBP GACTGTTCTTCACTCTTGGCTC SEQ. ID. NO: 4 Advanced GAPDH CATCATCTCTGCCCCCTCT SEQ. ID. NO: 5 Reverse GAPDH GGTGCTAAGCAGTTGGTGGT SEQ. ID. NO: 6
[00152] In vitro kinase assay [00153] In vitro kinase assay were performed as previously described using 1 pg of each COT (amino acids 30 to 397, R&D Systems) and inactive ERK1 (Millipore).
[00154] Cell viability assays [00155] The adhering RPMID7951 cells were infected with viruses that express shRNAs against COT or Luciferase as described above. Following selection, the cells were plated (1.5 x 10 ⁵ cells / reservoir) in a 24-plate quadruplicate plate. Viable cells were counted by trypan blue exclusion using a Cell Viability Analyzer VI □ CELL, according to the manufacturer's specifications. Quadruplicate cell counts were averaged and normalized to those in the control shRNA.
[00156] The Cancer Cell Line Encyclopedia (CCLE) [00157] The Cancer Cell Line Encyclopedia (CCLE) project is a collaboration between the Broad Institute, the Novartis Institutes for Biomedical Research (NIBR) and the Genomics Institute of the Novartis Research Foundation ( GNF) to conduct a detailed geenetic and pharmacological characterization of a large panel of human cancer models, to develop integrated computational analyzes that link distinct pharmacological vulnerabilities with genomic patterns and to
Petition 870190065596, of 07/12/2019, p. 55/131
50/120 translate cell line integrative genomics into stratification of cancer patient. The chromosome copy number and gene expression data used for this study are available online at http: //www.broadinstitute.orQ/cQi-bin/cancer/datasets.CQi.
[00158] Determination of the expression profile of cancer cell lines [00159] The microarray analysis of the oligonucleotide was performed using the GeneChip Human Genome 11133 Plus 2.0 Affymetrix (Affymetrix) expression array. The samples were converted to labeled, fragmented cRNA, following the Affymetrix protocol for use in the expression microarray.
[00160] The used shRNA constructs (pLKO. 1) [00161] The DNA sequences to prepare the used shRNA constructs were as follows:
shRNA OrTRC Identification NM No. Sequence SEQ.AT THE. ID. shLuc TRCN0000072243 AT CTTCGAAATGTCCGTTCGGTT SEQ.AT THE. 7 ID. shBRAF (1) TRCN0000006289 NM_004333.2-1106s1c1 CTTCGAAATGTCCGTTCGGTT SEQ.AT THE. 8 ID. shBRAF (2) TRCN0000006291 NM_004333,2-2267s1c1 GCTGGI I I CCAAACAGAGGAT SEQ.AT THE. 9 ID. shCRAF (1) TRCN0000001066 NM_002880.x-1236s1c1 CGGAGATGTTGCAGTAAAGAT SEQ.AT THE. 10 ID. shCRAF (2) TRCN0000001068 NM_002880.x-1529s1c1 GAGACATGAAATCCAACAATTHE SEQ.AT THE. 11 ID. shMEK1 (1) TRCN NM_002755. GATTACATAGTCAACGAGC SEQ. ID.
Petition 870190065596, of 07/12/2019, p. 56/131
51/120
0000002332 x-1015s1c1 CT AT THE. 12 shMEK1 (2) TRCN0000002329 NM_002755.x-455s1c1 GCTTCTATGGTGCGTTCTACTHE SEQ. ID.AT THE. 13 shMEK2 (1) TRCN0000007007 NM_030662,2-1219s1c1 TGGACTATATTGTGAACGAGC SEQ. ID.AT THE. 14 shMEK2 (2) TRCN0000007005 NM_030662,2-847s1c1 CCAACATCCTCGTGAACTCTTHE SEQ. ID.AT THE. 15 shCOT (1) TRCN0000010013 NM_005204.x-1826s1c1 CAAGAGCCGCAGACCTACTAA SEQ. ID.AT THE. 16 shCOT (2) TRCN0000196518 NM_005204,2-2809s1c1 GATGAGAATGTGACCI I I AAG SEQ. ID.AT THE. 17
[00162] The definitions and disclosures provided herein control and cancel all others incorporated by reference. Although the invention here has been described in connection with its preferred embodiments, it will be appreciated by those skilled in the art that additions, modifications, substitutions and deletions not specifically described can be made without departing from the spirit and scope of the invention as defined in the attached claims. It is, therefore, intended that the foregoing detailed description be considered as illustrative rather than limiting and that it is understood that it is the claims that follow, which include all equivalents, which are intended to define the spirit and scope of this invention.
[00163] Table 3: Description of the CCSB / Broad Institute Kinase ORF Library and ORF classification
Petition 870190065596, of 07/12/2019, p. 57/131
52/120 [00164] Abbreviations: RS / TK (Serine / Threonine Kinase Receptor); RTK (receptor tyrosine kinase); NRS / TK (Non-Receiving Serine / Threonine Kinase); NRTK (Non-receptor tyrosine kinase)
hGENE GENEID DESCRIPTION KINASE CLASS AAK1 22848 Kinase 1 associated with AP2 protein kinase(NRS / TK) ABL1 25 Abelson murine viral leukemia oncogene homologue 1 v-abl protein kinase (NRTK) ABL2 27 Abelson murine viral leukemia oncogene homolog 2 v-abl (arg, Abelson-related gene) protein kinase (NRTK) ACVR1 90 activin A receptor, type I protein kinase(RS / TK) ACVR1B 91 activin A receptor, type IB protein kinase(RS / TK) ACVR1Ç 130399 activin A receptor, type IC protein kinase(RS / TK) ACVR2THE 92 activin A receptor, type II protein kinase(RS / TK) ACVR2B 93 activin A receptor, type IIB protein kinase(RS / TK) ACVRL1 94 Equivalent to type II activin A receptor 1 protein kinase(RS / TK) ADCK1 57143 kinase 1 containing the aarF domain protein kinase ADCK2 90956 kinase 2 containing the aarF domain protein kinase ADCK4 79934 kinase 4 containing the aarF domain protein kinase ADPGK 83440 ADP-dependent glucokinase kinase related
Petition 870190065596, of 07/12/2019, p. 58/131
53/120
hGENE GENEID DESCRIPTION KINASE CLASS ADRBK1 156 adrenergic, beta, kinase receptor 1 protein kinase(NRS / TK) ADRBK2 157 adrenergic, beta, kinase receptor 2 protein kinase(NRS / TK) AGK 55750 substrate lipid kinasemultiple; MULK kinase related AK1 203 adenylate kinase 1 nucleotide kinase AK2 204 adenylate kinase 2 nucleotide kinase AK3 205 adenylate kinase 3 nucleotide kinase AK3L1 50808 adenylate kinase 3 as 1 nucleotide kinase AK7 122481 adenylate kinase 7 nucleotide kinase AKT1 207 homologue 1 of the viral oncogene of murine thymoma v-akt protein kinase(NRS / TK) AKT3 10000 homologous 3 of the viral oncogene of murine thymoma v-akt (protein B kinase, gamma) protein kinase(NRS / TK) ALDH18A1 5832 family 18 of the aldehyde dehydrogenase, member A1; ALDH18A1 kinase related ALK 238 anaplastic lymphoma kinase (Ki-1) protein kinase (RTK) ALPK1 80216 alpha kinase 1 protein kinase(NRS / TK) ALPK2 115701 alpha kinase 2 protein kinase(NRS / TK) ALS2CR7 65061 Chromosomal region of sclerosis 2amyotrophic lateral view (juvenile), candidate 7 protein kinase(NRS / TK) AMHR2 269 Receptor of anti-Mulerian hormone, protein kinase
Petition 870190065596, of 07/12/2019, p. 59/131
54/120
hGENE GENEID DESCRIPTION KINASE CLASS type II (RS / TK) ARAF 369 homologue 1 of the viral oncogene of3611 murine v-raf sarcoma protein kinase(N RS / TK) ARSG 22901 arylsulfatase G; ARSG kinase related ASCIZ 23300 Zn2 + finger protein that interacts with Chk2 on the ATM / ATR substrate; ASCIZ protein kinase(N RS / TK) AURKA 6790 serine / threonine kinase 6 protein kinase(N RS / TK) AURKB 9212 aurora kinase B protein kinase(N RS / TK) AURKC 6795 aurora kinase C protein kinase(N RS / TK) AXL 558 AXL receptor tyrosine kinase protein kinase (RTK) BCKDK 10295 branched-chain alpha-keto acid dehydrogenase kinase protein kinase BLK 640 B lymphoid tyrosine kinase protein kinase (NRTK) BMP2K 55589 BMP2-inducible kinase protein kinase(N RS / TK) BMP2KL 347359 as BMP2-inducible kinase protein kinase(N RS / TK) BMPR1THE 657 Bone morphogenetic protein receptor, type IA protein kinase(RS / TK) BMPR1 658 Morphogenetic protein receptor protein kinase
Petition 870190065596, of 07/12/2019, p. 60/131
55/120
hGENE GENEID DESCRIPTION KINASE CLASS Bbone, type IB (RS / TK) BMPR2 659 Bone morphogenetic protein receptor, type II (serine / threonine kinase) protein kinase(RS / TK) BMX 660 tyrosine kinase non-BMX receptor protein kinase (NRTK) BRAF 673 B1 homologue of the viral oncogene of murine v-raf sarcoma protein kinase(N RS / TK) BRD3 8019 containing bromodomain 3 protein kinase(N RS / TK) BRD4 23476 containing bromodomain 4 protein kinase(N RS / TK) BRSK1 84446 KIAA1811 protein protein kinase(N RS / TK) BRSK2 9024 serine / threonine kinase 29 protein kinase(N RS / TK) BTK 695 tyrosine kinase agammaglobulinemiaBruton protein kinase (NRTK) BUB1 699 BLIB1 sprouting not inhibited by benzimidazole homologue 1 (yeast) protein kinase(N RS / TK) BUB1B 701 BLIB1 sprouting not inhibited by beta benzimidazole homologue 1 (yeast) protein kinase(N RS / TK) C1orf57 84284 chromosome 1 open reading matrix57; C1orf57 kinase related C9orf95 54981 chromosome 9 open reading matrix95; C9orf95 kinase related C9orf98 158067 chromosome 9 open reading matrix nucleotide kinase
Petition 870190065596, of 07/12/2019, p. 61/131
56/120
hGENE GENEID DESCRIPTION KINASE CLASS 98; C9orf98CABC1 56997 chaperone, ABC1 activity of the equivalent bc1 complex (S. pombe) protein kinase CALM1 801 calmodulin 1 (phosphorylase kinase, delta) kinase related CALM2 805 calmodulin 2 (phosphorylase kinase, delta) kinase related CALM3 808 calmodulin 3 (phosphorylase kinase, delta) kinase related CAMK1 8536 calcium / calmodulin-dependent protein I kinase protein kinase(NRS / TK) CAMK1D 57118 calcium / calmodulin-dependent protein kinase ID protein kinase(NRS / TK) CAMK1G 57172 calcium / calmodulin-dependent IG protein kinase protein kinase(NRS / TK) CAMK2THE 815 protein kinase (CaM kinase) II calcium-dependent alpha / calmodulin protein kinase(NRS / TK) CAMK2B 816 calcium-dependent protein kinase (CaM kinase) II beta / calmodulin protein kinase(NRS / TK) CAMK2D 817 protein kinase (CaM kinase) II calcium-dependent delta / calmodulin protein kinase(NRS / TK) CAMK2G 818 protein kinase (CaM kinase) II calcium / calmodulin dependent range protein kinase(NRS / TK) CAMK4 814 calcium / calmodulin-dependent protein kinase IV protein kinase(NRS / TK) CAMKK1 84254 protein kinase kinase 1, calcium-dependent alpha / calmodulin protein kinase(NRS / TK)
Petition 870190065596, of 07/12/2019, p. 62/131
57/120
hGENE GENEID DESCRIPTION KINASE CLASS CAMKK2 10645 protein kinase kinase 2, calcium-dependent beta / calmodulin protein kinase(NRS / TK) CAMKV 79012 hypothetical protein MGC8407 protein kinase(NRS / TK) CARD11 84433 family from the caspase recruitment domain, member 11; CARD11 nucleotide kinase CARKL 23729 kinase-equivalent carbohydrate carbohydrate kinase CASK 8573 your calcium-calmodulin-dependent protein kinase (MAGUK family) nucleotide kinase CCL2 6347 Chemokine ligand (C-C motif) 2;CCL2 protein kinase CCL4 6351 Chemokine ligand (motif C-C) 4;CCL4 protein kinase (RTK) CCRK 23552 cell cycle-related kinase protein kinase(NRS / TK) CD2 914 CD2 antigen (p50), sheep red blood cell receptor; CD2 protein kinase CDC2 983 cell division cycle 2, G1 to S and G2 toM protein kinase(NRS / TK) CDC2L1 984 2-equivalent cell division cycle 1 (PITSLRE proteins) protein kinase(NRS / TK) CDC2L2 985 2-equivalent cell division cycle 2 (PITSLRE proteins) protein kinase(NRS / TK) CDC2L6 23097 2-equivalent cell division cycle 6 (CDK8-equivalent) protein kinase(NRS / TK) CDC42BPG 55561 gamma protein kinase that binds CDC42(DMPK-equivalent) protein kinase(NRS / TK)
Petition 870190065596, of 07/12/2019, p. 63/131
58/120
hGENE GENEID DESCRIPTION KINASE CLASS CDC7 8317 CDC7 cell division cycle 7 (S. cerevisiae) protein kinase(NRS / TK) CDK10 8558 cyclin-dependent kinase (equivalent CDC2) 10 protein kinase(NRS / TK) CDK2 1017 cyclin-dependent kinase 2 protein kinase(NRS / TK) CDK3 1018 cyclin-dependent kinase 3 protein kinase(NRS / TK) CDK4 1019 cyclin-dependent kinase 4 protein kinase(NRS / TK) CDK5 1020 cyclin-dependent kinase 5 protein kinase(NRS / TK) CDK5R1 8851 cyclin-dependent kinase 5, regulatory subunit 1 (p35) protein kinase(NRS / TK) CDK6 1021 cyclin 6 dependent kinase protein kinase(NRS / TK) CDK7 1022 cyclin 7 dependent kinase (homologue MO15, Xenopus laevis, cdk activating kinase) protein kinase(NRS / TK) CDK8 1024 cyclin-dependent kinase 8 protein kinase(NRS / TK) CDK9 1025 cyclin 9-dependent kinase (CDC2-related kinase) protein kinase(NRS / TK) CDKL1 8814 cyclin-equivalent dependent kinase1 (CDC2-related kinase) protein kinase(NRS / TK) CDKL2 8999 cyclin-equivalent dependent kinase2 (CDC2-related kinase) protein kinase(NRS / TK)
Petition 870190065596, of 07/12/2019, p. 64/131
59/120
hGENE GENEID DESCRIPTION KINASE CLASS CDKL3 51265 cyclin-equivalent dependent kinase3 protein kinase(NRS / TK) CDKL4 344387 cyclin-equivalent dependent kinase4 protein kinase(NRS / TK) CDKL5 6792 cyclin-equivalent dependent kinase5 protein kinase(NRS / TK) CHEK1 1111 checkpoint counterpart CHK1(S. pombe) protein kinase(NRS / TK) CHEK2 11200 checkpoint counterpart CHK2(S. pombe) protein kinase(NRS / TK) CHKA 1119 choline kinase alpha kinase related CIB1 10519 binding of calcium and integrin 1 (calmirin); kinase related CIB4 130106 member of family 4 of the calcium and integrin bond; CIB4 kinase related CKB 1152 creatine kinase, cerebral kinase related CKM 1158 creatine kinase, muscle kinase related CKMT1THE 548596 creatine kinase, mitochondrial 1A;CKMT1A kinase related CKMT2 1160 creatine kinase, mitochondrial 2 (sarcomeric) kinase related CKS1B 1163 subunit CDC28 protein kinaseregulator 1B protein kinase CKS2 1164 subunit CDC28 protein kinase protein kinase
Petition 870190065596, of 07/12/2019, p. 65/131
60/120
hGENE GENEID DESCRIPTION KINASE CLASS regulator 2CLK1 1195 kinase 1 equivalent to CDC protein kinase(N RS / TK) CLK2 1196 CDC equivalent kinase 2 protein kinase(N RS / TK) CLK3 1198 CDC equivalent kinase 3 protein kinase(N RS / TK) COASY 80347 Coenzyme A synthase; COASY kinase related COL4A3BP 10087 collagen-binding protein, type IV, alpha 3 (Goodpasture antigen); COL4A3BP protein kinase CRKL 1399 equivalent of the homologous (avian) oncogene CT10 of the v-crk sarcoma virus; CRKL kinase related CSF1R 1436 colony stimulating factor receptor 1, formerly homologous to McDonough feline viral sarcoma oncogene (v-fms) protein kinase (RTK) CSK 1445 tyrosine kinase c-src protein kinase (NRTK) CSNK1TO 1 1452 casein kinase 1, alpha 1 protein kinase(N RS / TK) CSNK1A1L 122011 casein kinase 1, alpha 1-equivalent protein kinase(N RS / TK) CSNK1D 1453 casein kinase 1, delta protein kinase(N RS / TK)
Petition 870190065596, of 07/12/2019, p. 66/131
61/120
hGENE GENEID DESCRIPTION KINASE CLASS CSNK1AND 1454 casein kinase 1, epsilon protein kinase(NRS / TK) CSNK1G1 53944 casein kinase 1, range 1 protein kinase(NRS / TK) CSNK1G2 1455 casein kinase 1, range 2 protein kinase(NRS / TK) CSNK1G3 1456 casein kinase 1, range 3 protein kinase(NRS / TK) CSNK2TO 1 1457 casein kinase 2, alpha 1 polypeptide protein kinase(NRS / TK) CSNK2B 1460 casein kinase 2, beta polypeptide protein kinase(NRS / TK) DAK 26007 homologous dihydroxyacetone kinase 2 (S. cerevisiae); DAK kinase related DAPK1 1612 protein kinase associated with death 1 protein kinase(NRS / TK) DAPK2 23604 protein kinase associated with death 2 protein kinase(NRS / TK) DAPK3 1613 protein kinase associated with death 3 protein kinase(NRS / TK) DCAKD 79877 domain containing the phosphorus-CoA kinase;DCAKD kinase related DCAMKL2 166614 hypothetical protein MGC45428 protein kinase(NRS / TK) DCK 1633 deoxycytidine kinase nucleotide kinase DDR1 780 domain receiver familydiscoidina, member 1 protein kinase (RTK)
Petition 870190065596, of 07/12/2019, p. 67/131
62/120
hGENE GENEID DESCRIPTION KINASE CLASS DDR2 4921 domain receiver familydiscoidina, member 2 protein kinase (RTK) DGKA 1606 diacylglycerol kinase, alpha 80 kDa kinase related DGKB 1607 diacylglycerol kinase, beta 90 kDa kinase related DGKG 1608 diacylglycerol kinase, range 90 kDa kinase related DGKK 139189 diacylglycerol kinase, cap; DGKK kinase related DGKZ 8525 diacylglycerol kinase, zeta 104 kDa kinase related DGUOK 1716 deoxyguanosine kinase nucleotide kinase DKFZp434B1231 91156 EEF1A2 binding protein;DKFZp434B1231 protein kinase(NRS / TK) DKFZp761P0423 157285 hypothetical protein DKFZp761P0423 protein kinase(RS / TK) DLG1 1739 discs, large counterpart 1 (Drosophila);DLG1 nucleotide kinase DLG3 1741 discs, counterpart 3 large(neuroendocrine-dlg, Drosophila); DLG3 nucleotide kinase DTYMK 1841 deoxythymidylate kinase (thymidylate kinase) nucleotide kinase DYRK1THE 1859 kinase 1A regulated by tyrosine phosphorylation- (Y) dual specificity protein kinase(NRS / TK) DYRK1 9149 kinase 1B regulated by phosphorylation of protein kinase
Petition 870190065596, of 07/12/2019, p. 68/131
63/120
hGENE GENEID DESCRIPTION KINASE CLASS Btyrosine- (Y) dual specificity (NRS / TK) DYRK2 8445 kinase 2 regulated by tyrosine phosphorylation- (Y) dual specificity protein kinase(NRS / TK) DYRK3 8444 kinase 3 regulated by tyrosine phosphorylation- (Y) dual specificity protein kinase(NRS / TK) DYRK4 8798 kinase 4 regulated by tyrosine phosphorylation- (Y) dual specificity protein kinase(NRS / TK) EEF2K 29904 eukaryotic elongation factor kinase-2 protein kinase(NRS / TK) EGFR 1956 epidermal growth factor receptor (homologous to the viral oncogene of ehtroblastic leukemia (v-erb-b), avian) protein kinase (RTK) EIF2AK1 27102 Hemeregulated initiation factor alpha-2 kinase protein kinase(NRS / TK) EIF2AK4 415116 protein / threonine kinase pim-3 protein kinase(RS / TK) EPHA1 2041 EPH A1 Receiver protein kinase (RTK) EPHA2 1969 EPH A2 Receiver protein kinase (RTK) EPHA3 2042 EPH A3 Receiver protein kinase (RTK) EPHA4 2043 EPH A4 receiver protein kinase (RTK) EPHA6 285220 EPH A6 Receiver protein kinase (RTK)
Petition 870190065596, of 07/12/2019, p. 69/131
64/120
hGENE GENEID DESCRIPTION KINASE CLASS EPHB1 2047 EPH B1 Receiver protein kinase (RTK) EPHB4 2050 EPH B4 Receiver protein kinase (RTK) EPHB6 2051 EPH B6 Receiver protein kinase (RTK) ERBB2 2064 homologue of viral oncogene 2 of erythroblastic leukemia v-erb-b2,neuro / glioblastoma-derived oncogene homologue (avian) protein kinase (RTK) ERBB3 2065 homologue of the viral oncogene 3 of erythroblastic leukemia v-erb-b2 (avian) protein kinase (RTK) ERBB4 2066 homologue of viral oncogene 4 of erythroblastic leukemia v-erb-a (avian) protein kinase (RTK) ERN1 2081 Signaling of the endoplasmic reticulumfor core 1 protein kinase ETNK1 55500 ethanolamine kinase 1 kinase related ETNK2 55224 ethanolamine kinase 2 kinase related EXOSC10 5394 Exosome component 10; EXOSC10 protein kinase(NRS / TK) FASTK 10922 FAST kinase protein kinase(NRS / TK) FASTKD1 79675 domains 1 of FAST kinase; FASTKD1 protein kinase FASTK 22868 domains 2 of FAST kinase; FASTKD2 protein kinase
Petition 870190065596, of 07/12/2019, p. 70/131
65/120
hGENE GENEID DESCRIPTION KINASE CLASS D2 FASTKD3 79072 domains 3 of FAST kinase; FASTKD3 protein kinase FASTKD5 60493 domains 5 of FAST kinase; FASTKD5 protein kinase FER 2241 fer (related to fps / fes) tyrosine kinase (phosphoprotein NCP94) protein kinase (NRTK) FES 2242 oncogene of feline sarcoma protein kinase (NRTK) FGFR1 2260 fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) protein kinase (RTK) FGFR2 2263 fibroblast growth factor receptor 2 (craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer and JacksonWeiss) protein kinase (RTK) FGFR3 2261 fibroblast growth factor receptor 3 (achondroplasia, Thanatophoric dwarfism) protein kinase (RTK) FGFRL1 53834 equivalent to fibroblast growth factor receptor 1; FGFRL1 protein kinase (RTK) FGR 2268 homologue of the oncogene of Gardner-Rasheed feline viral sarcoma (v-fgr) protein kinase (NRTK) FLJ10986 55277 hypothetical protein FLJ10986; FLJ10986 carbohydrate kinase FLJ23356 84197 hypothetical protein FLJ23356 protein kinase
Petition 870190065596, of 07/12/2019, p. 71/131
66/120
hGENE GENEID DESCRIPTION KINASE CLASS FLJ25006 124923 hypothetical protein FLJ25006 protein kinase(NRS / TK) FLJ40852 285962 hypothetical protein FLJ40852 protein kinase FLT1 2321 fms-related tyrosine kinase 1 (vascular endothelial growth factor / vascular permeability factor receptor) protein kinase (RTK) FLT3 2322 fms-related tyrosine kinase 3 protein kinase (RTK) FLT4 2324 fms-related tyrosine kinase 4 protein kinase (RTK) FN3K 64122 fructosamine 3 kinase kinase related FN3KRP 79672 fructosamine-related protein3-kinase kinase related FRK 2444 fyn related kinase protein kinase (NRTK) FUK 197258 fucokinase kinase related FXN 2395 frataxin; FXN kinase related FYN 2534 FYN oncogene related to SRC, FGR, YES protein kinase (NRTK) GALK1 2584 galactokinase 1 carbohydrate kinase GALK2 2585 galactokinase 2 carbohydrate kinase GCK 2645 glucokinase (hexokinase 4, diabetes mellitus carbohydrate kinase
Petition 870190065596, of 07/12/2019, p. 72/131
67/120
hGENE GENEID DESCRIPTION KINASE CLASS beginning at youth maturity 2)GK 2710 glycerol kinase carbohydrate kinase GK2 2712 glycerol kinase 2 carbohydrate kinase GK5 256356 hypothetical MGC40579 protein;MGC40579 carbohydrate kinase GLYCTK 132158 glycerate kinase carbohydrate kinase GNE 10020 glucosamine (UDP-N-acetyl) -2-epimerase / N-acetyl mannosamine kinase carbohydrate kinase GRK6 2870 G protein-bound receptor kinase 6 protein kinase(NRS / TK) GRK7 131890 G protein-bound receptor kinase 7 protein kinase(NRS / TK) GSG2 83903 haspine protein kinase(RS / TK) GSK3A 2931 glycogen synthase kinase 3 alpha protein kinase(NRS / TK) GTF2H1 2965 general transcription factor IIH, polypeptide 1.62 kDa; GTF2H1 protein kinase(NRS / TK) GUK1 2987 guanylate kinase 1 nucleotide kinase HCK 3055 hemopoietic cell kinase protein kinase (NRTK) HIPK1 204851 protein kinase 1 that interacts with homeodomain protein kinase(NRS / TK) HIPK2 28996 protein kinase 2 that interacts with homeodomain protein kinase(NRS / TK) HIPK3 10114 protein kinase 3 that interacts with protein kinase
Petition 870190065596, of 07/12/2019, p. 73/131
68/120
hGENE GENEID DESCRIPTION KINASE CLASS home domain (NRS / TK) HIPK4 147746 protein kinase 4 that interacts with homeodomain protein kinase(NRS / TK) HK1 3098 hexokinase 1 carbohydrate kinase HK2 3099 hexokinase 2 carbohydrate kinase HK3 3101 hexokinase 3 (white cell) carbohydrate kinase HKDC1 80201 domain 1 containing hexokinase; HKDC1 carbohydrate kinase HSPB8 26353 heat shock 22 kDa protein 8 protein kinase(NRS / TK) IGF1R 3480 Insulin-equivalent growth factor 1 receptor protein kinase (RTK) IHPK1 9807 inositol hexaphosphate kinase 1 kinase related IHPK2 51447 inositol hexaphosphate kinase 2 Lipid Kinase IHPK3 117283 inositol hexaphosphate kinase 3 Lipid Kinase IKBKE 9641 inhibitor of the light coat polypeptide gene enhancer in B cells, epsilon kinase protein kinase(NRS / TK) ILK 3611 integrin-bound kinase protein kinase(NRS / TK) INSRR 3645 receptor related to the insulin receptor protein kinase (RTK) IPMK 253430 inositol polyphosphate multicinase Lipid Kinase IPPK 64768 inositol 1,3,4,5,6-pentacisphosphate 2 kinase; IPPK Lipid Kinase IRAK2 3656 kinase 2 associated with the interleukin-1 receptor protein kinase(RS / TK)
Petition 870190065596, of 07/12/2019, p. 74/131
69/120
hGENE GENEID DESCRIPTION KINASE CLASS IRAK3 11213 kinase 3 associated with the interleukin-1 receptor protein kinase(RS / TK) IRAK4 51135 kinase 4 associated with the interleukin-1 receptor protein kinase(RS / TK) ITGB1BP3 27231 protein 3 that binds integrin beta 1;ITGB1BP3 kinase related ITK 3702 IL2-inducible T cell kinase protein kinase (NRTK) ITPKB 3707 inositol 1,4,5-triphosphate 3-kinase B kinase related JAK1 3716 Janus kinase 1 (a protein tyrosine kinase) protein kinase (NRTK) JAK2 3717 Janus kinase 2 (a protein tyrosine kinase) protein kinase (NRTK) JAK3 3718 Janus kinase 3 (a protein tyrosine kinase, leukocyte) protein kinase (NRTK) KDR 3791 kinase insert domain receptor (a type III receptor tyrosine kinase) protein kinase (RTK) KHK 3795 ketoexokinase (fructokinase) carbohydrate kinase KIAA0999 23387 protein KIAA0999 protein kinase(RS / TK) KIAA2002 79834 KIAA2002 protein protein kinase(RS / TK) KSR 8844 ras suppressor kinase protein kinase(N RS / TK) KSR2 283455 Ras-2 suppressing kinase protein kinase(N RS / TK)
Petition 870190065596, of 07/12/2019, p. 75/131
70/120
hGENE GENEID DESCRIPTION KINASE CLASS LATS1 9113 LATS, large tumor suppressor, homologue 1 (Drosophila) protein kinase(NRS / TK) LATS2 26524 LATS, large tumor suppressor, homologous 2 (Drosophila) protein kinase(NRS / TK) LCK 3932 lymphocyte-specific protein tyrosine kinase protein kinase (NRTK) LIMK1 3984 LIM domain kinase 1 protein kinase(NRS / TK) LIMK2 3985 LIM domain kinase 2 protein kinase(NRS / TK) LMTK2 22853 lemur tyrosine kinase 2 protein kinase (RTK) LOC220686 220686 hypothetical LOC220686 protein;LOC220686 kinase related LOC340156 340156 hypothetical protein LOC340156 protein kinase(NRS / TK) LOC340371 340371 hypothetical protein LOC340371 protein kinase(NRS / TK) LOC375133 375133 similar to phosphatidylinositol 4-kinase alfa Lipid Kinase LOC388957 388957 similar to BMP2-inducible kinase protein kinase(NRS / TK) LOC389599 389599 chr region. similar to amyotrophic lateral sclerosis 2 (juvenile), candidate 2; protein that interacts with ILP ILPIPA protein kinase LOC390877 390877 similar to adenylate kinase (EC 2.7.4.3), cytosolic - common carp nucleotide kinase
Petition 870190065596, of 07/12/2019, p. 76/131
71/120
hGENE GENEID DESCRIPTION KINASE CLASS LOC442075 442075 similar to serine / threonine kinase, establishes embryonic polarity protein kinase(NRS / TK) LOC54103 54103 hypothetical LOC54103 protein;LOC54103 protein kinase (RTK) LOC646505 646505 similar to dual specificity protein kinase CLK3 (CDC equivalent kinase 3); unassigned protein kinase(NRS / TK) LOC647279 647279 similar to kinase 3 that regulates MAP / microtubule affinity; unassigned protein kinase(NRS / TK) LOC648152 648152 similar to ataxia telangiectasia and related to the Rad3 protein; unassigned protein kinase(NRS / TK) LOC649288 649288 similar to adenylate kinase isoenzyme 4, mitochondrial (Adenylate kinase 3 equivalent 1) nucleotide kinase LOC650122 650122 similar to choline kinase alpha isoform a; unassigned kinase related LOC652722 652722 similar to the PTK2 protein tyrosine kinase 2 isoform a; unassigned protein kinase (NRTK) LOC652799 652799 similar to the precursor to Mastoid growth factor / stem cell (SCFR) (c-kit) (CD117 antigen); unassigned protein kinase (RTK) LOC653052 653052 similar to protein kinase 2 that interacts with homeodomain (hHIPk2); unassigned protein kinase(NRS / TK)
Petition 870190065596, of 07/12/2019, p. 77/131
72/120
hGENE GENEID DESCRIPTION KINASE CLASS LOC653155 653155 similar to factor B homologue B that processes the PRP4 pre-mRNA; unassigned protein kinase(NRS / TK) LOC727761 727761 similar to deoxythymidylate kinase (thymidylate kinase); unassigned nucleotide kinase LOC730000 730000 similar to testis-specific serine kinase 6; unassigned protein kinase(NRS / TK) LOC732306 732306 similar to vaccinia-related kinase 2; unassigned protein kinase(NRS / TK) LOC91461 91461 hypothetical protein BC007901 protein kinase (NRTK) LOC91807 91807 myosin light chain kinase (MLCK) protein kinase(NRS / TK) LRGUK 136332 Repetitions rich in leucine and containing the guanylate kinase domain; LRGUK nucleotide kinase LRPPRÇ 10128 Contains the leucine-rich PPR motif;LRPPRC protein kinase(RS / TK) LRRK2 120892 leucine-rich repeat kinase 2 protein kinase(NRS / TK) LYK5 92335 protein kinase LYK5 protein kinase LYN 4067 oncogene counterpart related to Yamaguchi viral sarcoma v-yes-1 protein kinase (NRTK) MAGI1 9223 membrane-associated guanylate kinase, containing the WW and PDZ 1 domains; MAGI 1 nucleotide kinase MAK 4117 male germ cell associated kinase protein kinase(NRS / TK)
Petition 870190065596, of 07/12/2019, p. 78/131
73/120
hGENE GENEID DESCRIPTION KINASE CLASS MAP2K1 5604 mitogen-activated protein kinasekinase 1 protein kinase MAP2K1IP1 8649 mitogen-activated protein kinaseprotein kinase 1 intervening 1 protein kinase MAP2K2 5605 mitogen-activated protein kinasekinase 2 protein kinase MAP2K5 5607 mitogen-activated protein kinasekinase 5 protein kinase MAP2K6 5608 mitogen-activated protein kinasekinase 6 protein kinase MAP2K7 5609 mitogen-activated protein kinasekinase 7 protein kinase MAP3K11 4296 mitogen activated protein kinase kinase 11 protein kinase(N RS / TK) MAP3K12 7786 mitogen-activated protein kinase kinase 12 protein kinase(N RS / TK) MAP3K14 9020 mitogen-activated protein kinase kinase 14 protein kinase MAP3K15 389840 protein FLJ16518 protein kinase MAP3K2 10746 mitogen-activated protein kinase kinase 2 protein kinase MAP3K5 4217 mitogen-activated protein kinase kinase 5 protein kinase MAP3K6 9064 mitogen-activated protein kinase kinase 6 protein kinase MAP3K 6885 protein kinase kinase 7 kinase protein kinase
Petition 870190065596, of 07/12/2019, p. 79/131
74/120
hGENE GENEID DESCRIPTION KINASE CLASS 7mitogen-activated (NRS / TK) MAP3K8 1326 mitogen-activated protein kinase kinase 8 protein kinase MAP4K1 11184 mitogen-activated protein kinase kinase kinase 1 protein kinase MAP4K2 5871 mitogen activated protein kinase kinase kinase 2 protein kinase MAP4K3 8491 mitogen-activated protein kinase kinase kinase 3 protein kinase MAP4K4 9448 mitogen activated protein kinase kinase kinase 4 protein kinase MAP4K5 11183 mitogen activated protein kinase kinase kinase 5 protein kinase MAPK1 5594 mitogen-activated protein kinase1 protein kinase(NRS / TK) MAPK10 5602 mitogen-activated protein kinase10 protein kinase(NRS / TK) MAPK12 6300 mitogen-activated protein kinase12 protein kinase(NRS / TK) MAPK13 5603 mitogen-activated protein kinase13 protein kinase(NRS / TK) MAPK14 1432 mitogen-activated protein kinase14 protein kinase(NRS / TK) MAPK15 225689 extracellular signal-regulated kinase 8 protein kinase(NRS / TK) MAPK3 5595 mitogen-activated protein kinase3 protein kinase(NRS / TK)
Petition 870190065596, of 07/12/2019, p. 80/131
75/120
hGENE GENEID DESCRIPTION KINASE CLASS MAPK4 5596 mitogen-activated protein kinase4 protein kinase(NRS / TK) MAPK6 5597 mitogen-activated protein kinase6 protein kinase(NRS / TK) MAPK8 5599 mitogen-activated protein kinase8 protein kinase(NRS / TK) MAPK9 5601 mitogen-activated protein kinase9 protein kinase(NRS / TK) ΜΑΡΚΑPK2 9261 mitogen-activated protein kinaseactivated protein kinase 2 protein kinase(NRS / TK) ΜΑΡΚΑPK3 7867 mitogen-activated protein kinaseactivated protein kinase 3 protein kinase(NRS / TK) ΜΑΡΚΑPK5 8550 mitogen-activated protein kinaseactivated protein kinase 5 protein kinase(NRS / TK) MARK2 2011 kinase 2 that regulates MAP / microtubule affinity protein kinase(NRS / TK) MARK3 4140 kinase 3 that regulates MAP / microtubule affinity protein kinase(NRS / TK) MAST1 22983 serine / threonine kinase 1 associated with microtubule protein kinase(NRS / TK) MAST2 23139 serine / threonine kinase 2 associated with microtubule protein kinase(NRS / TK) MASTL 84930 Equivalent to serine / threonine kinase associated with microtubule protein kinase(NRS / TK) MATK 4145 megakaryocyte-associated tyrosine kinase protein kinase (NRTK) MERTK 10461 proto-oncogene tyrosine kinase c-mer protein kinase
Petition 870190065596, of 07/12/2019, p. 81/131
76/120
hGENE GENEID DESCRIPTION KINASE CLASS (RTK) MET 4233 proto-oncogene met (hepatocyte growth factor receptor) protein kinase (RTK) MGC16169 93627 hypothetical protein MGC16169 protein kinase MGC42105 167359 hypothetical protein MGC42105 protein kinase(NRS / TK) MINK1 50488 Misshapen / NIK related kinase protein kinase MKNK1 8569 serine / threonine kinase 1 that interacts with MAP kinase protein kinase(NRS / TK) MKNK2 2872 serine / threonine kinase 2 that interacts with MAP kinase protein kinase(NRS / TK) M0RN2 378464 MORN repetition containing 2;MORN2 kinase related MOS 4342 homologue of the viral oncogene of Moloney's murine sarcomo see protein kinase(NRS / TK) MPP1 4354 Membrane protein, palmitoylated 1,55 kDa; MPP1 protein kinase MPP2 4355 Membrane protein, palmitoylated 2 (member 2 of the MAGUK p55 subfamily); MPP2 nucleotide kinase MPP3 4356 membrane protein, palmitoylated 3 (member 3 of the MAGUK p55 subfamily); MPP3 nucleotide kinase MPP4 58538 membrane protein, palmitoylated 4 (member 4 of the p55 subfamily of MAGUK); MPP4 nucleotide kinase
Petition 870190065596, of 07/12/2019, p. 82/131
77/120
hGENE GENEID DESCRIPTION KINASE CLASS MPP5 64398 membrane protein, palmitoylated 5 (member 5 of the p55 subfamily of MAGUK); MPP5 nucleotide kinase MPP6 51678 membrane protein, palmitoylated 6 (member 6 of the MAGUK p55 subfamily); MPP6 nucleotide kinase MPP7 143098 membrane protein, palmitoylated 7 (member 7 of the MAGUK p55 subfamily); MPP7 nucleotide kinase MST1R 4486 macrophage-stimulating receptor 1 (c-met-related tyrosine kinase) protein kinase (RTK) MUSK 4593 muscle, skeletal, receptor tyrosine kinase protein kinase (RTK) MVK 4598 mevalonate kinase (mevalonic aciduria) kinase related MILK2 85366 myosin light chain kinase 2, skeletal muscle protein kinase(N RS / TK) MY03B 140469 myosin IIIB protein kinase(N RS / TK) NADK 65220 NAD kinase kinase related NAGK 55577 N-acetylglycosamine kinase kinase related NEK10 152110 NIMA-related kinase 10 (never in mitosis gene a) protein kinase NEK11 79858 NIMA-related kinase 11 (never in mitosis gene a) protein kinase
Petition 870190065596, of 07/12/2019, p. 83/131
78/120
hGENE GENEID DESCRIPTION KINASE CLASS NEK2 4751 NIMA-related kinase 2 (never in mitosis gene a) protein kinase NEK3 4752 NIMA-related kinase 3 (never in mitosis gene a) protein kinase NEK4 6787 NIMA-related kinase 4 (never in mitosis gene a) protein kinase NEK5 341676 NIMA-related kinase 5 (never in mitosis gene a) protein kinase NEK6 10783 NIMA-related kinase 6 (never in mitosis gene a) protein kinase NEK7 140609 NIMA-related kinase 7 (never in mitosis gene a) protein kinase NEK8 284086 NIMA-related kinase 8 (never in mitosis gene a) protein kinase NEK9 91754 NIMA-related kinase 9 (never in mitosis gene a) protein kinase NJMU-R1 64149 protein kinase Njmu-R1 protein kinase NLK 51701 nemo as kinase protein kinase(NRS / TK) NME1 4830 nucleoside-diphosphate kinase 1 nucleotide kinase NME1-NME2 654364 Protein NME1-NME2; NME1-NME2 nucleotide kinase NME2 4831 nucleoside-diphosphate kinase 2 nucleotide kinase NME3 4832 nucleoside-diphosphate kinase 3 nucleotide kinase NME4 4833 nucleoside-diphosphate kinase 4 nucleotide kinase NME5 8382 non-metastatic cells 5, protein nucleotide kinase
Petition 870190065596, of 07/12/2019, p. 84/131
79/120
hGENE GENEID DESCRIPTION KINASE CLASS expressed in (nucleoside-diphosphate kinase)NME6 10201 non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase) nucleotide kinase NME7 29922 non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase) nucleotide kinase NPR2 4882 peptide B receptornatriuretic / guanylate cyclase B (atrionatriuretic peptide B receptor) protein kinase NRBP 29959 nuclear receptor binding protein protein kinase(NRS / TK) NTRK1 4914 neurotrophic tyrosine kinase, receptor, type1 protein kinase (RTK) NTRK2 4915 neurotrophic tyrosine kinase, receptor, type2 protein kinase (RTK) NTRK3 4916 neurotrophic tyrosine kinase, receptor, type3 protein kinase (RTK) NUAK2 81788 Probable orthologist of the mouse activated SNF1 / AMP protein kinase protein kinase(NRS / TK) NUP62 23636 62 kDa nucleoporin; NUP62 protein kinase(NRS / TK) NYD-SP25 89882 NYD-SP25 protein kinase protein kinase 0XSR1 9943 responsive oxidative stress 1 protein kinase PAK1 5058 p21 / Cdc42 / Rac1 activated kinase 1 protein kinase
Petition 870190065596, of 07/12/2019, p. 85/131
80/120
hGENE GENEID DESCRIPTION KINASE CLASS (STE20 counterpart, yeast)PAK2 5062 p21-activated kinase 2 (CDKN1A) protein kinase PAK3 5063 p21-activated kinase 3 (CDKN1A) protein kinase PAK4 10298 p21-activated kinase 4 (CDKN1A) protein kinase PAK6 56924 p21 activated kinase 6 (CDKN1A) protein kinase PAK7 57144 p21-activated kinase 7 (CDKN1A) protein kinase PANK2 80025 pantothenate kinase 2 (Hallervorden-Spatz) kinase related PANK3 79646 pantothenate kinase 3 kinase related PANK4 55229 pantothenate kinase 4 kinase related PAPSS1 9061 3’-phosphoadenosine 5’-phosphosulfate synthase1; PAPSS1 kinase related PAPSS2 9060 3’-phosphoadenosine 5’-phosphosulfate synthase2; PAPSS2 kinase related PBK 55872 protein kinase originated in the T-cellLAK protein kinase PCK2 5106 phosphoenolpyruvate carboxicin 2 (mitochondrial) kinase related PCTK1 5127 PCTAIRE protein kinase 1 protein kinase(NRS / TK) PCTK2 5128 PCTAIRE protein kinase 2 protein kinase(NRS / TK) PCTK3 5129 PCTAIRE protein kinase 3 protein kinase(NRS / TK) PDGFR 5156 derived growth factor receptor protein kinase
Petition 870190065596, of 07/12/2019, p. 86/131
81/120
hGENE GENEID DESCRIPTION KINASE CLASS THEplatelet, alpha polypeptide (RTK) PDGFRB 5159 platelet-derived growth factor receptor, beta polypeptide protein kinase (RTK) PDGFRL 5157 equivalent to the platelet-derived growth factor receptor; PDGFRL protein kinase (RTK) PDIK1L 149420 Equivalent to kinase 1 which interacts withPDLIM1 protein kinase(NRS / TK) PDK1 5163 pyruvate dehydrogenase kinase,isoenzyme 1 protein kinase PDK2 5164 pyruvate dehydrogenase kinase,isoenzyme 2 protein kinase PDK3 5165 pyruvate dehydrogenase kinase,isoenzyme 3 protein kinase PDK4 5166 pyruvate dehydrogenase kinase,isoenzyme 4 protein kinase PDPK1 5170 3 phosphinosinoside-dependent protein kinase 1 protein kinase PDXK 8566 pyridoxal (pyridoxine, vitamin B6) kinase kinase related PFKFB1 5207 6-phosphofruct-2-kinase / fructose-2,6-bisphosphatase 1 carbohydrate kinase PFKFB2 5208 6-phosphofruct-2-kinase / fructose-2,6-bisphosphatase 2 carbohydrate kinase PFKFB3 5209 6-phosphofruct-2-kinase / fructose-2,6-bisphosphatase 3 carbohydrate kinase PFKL 5211 phosphofrutokinase, liver carbohydrate kinase
Petition 870190065596, of 07/12/2019, p. 87/131
82/120
hGENE GENEID DESCRIPTION KINASE CLASS PFKM 5213 phosphofrutokinase, muscle carbohydrate kinase PFKP 5214 phosphofrutokinase, platelet carbohydrate kinase PFTK1 5218 PFTAIRE protein kinase 1 protein kinase(NRS / TK) PGK1 5230 phosphoglycerate kinase 1 carbohydrate kinase PGK2 5232 phosphoglycerate kinase 2 carbohydrate kinase PHKA1 5255 phosphorylase kinase, alpha 1 (muscle) protein kinase(NRS / TK) PHKA2 5256 phosphorylase kinase, alpha 2 (liver) protein kinase(NRS / TK) PHKB 5257 phosphorylase kinase, beta protein kinase(NRS / TK) PHKG1 5260 phosphorylase kinase, gamma 1 (muscle) protein kinase(NRS / TK) PHKG2 5261 phosphorylase kinase, range 2 (testis) protein kinase(NRS / TK) PI4K2B 55300 phosphatidylinositol 4-kinase type-ll beta Lipid Kinase PI4KII 55361 phosphatidylinositol 4-kinase type II Lipid Kinase PIK3C2G 5288 phosphoinositide-3-kinase, class 2, polypeptide range Lipid Kinase PIK3C3 5289 phosphoinositide-3-kinase, class 3 Lipid Kinase PIK3CA 5290 phosphoinositide-3-kinase, catalytic, alpha polypeptide Lipid Kinase PIK3CBP 5291 phosphoinositide-3-kinase, catalytic, beta polypeptide Lipid Kinase PIK3CG 5294 phosphoinositide-3-kinase, catalytic, gamma polypeptide Lipid Kinase
Petition 870190065596, of 07/12/2019, p. 88/131
83/120
hGENE GENEID DESCRIPTION KINASE CLASS PIK3R1 5295 phosphoinositide-3-kinase, subunitregulator 1 (p85 alpha) Lipid Kinase PIK3R3 8503 phosphoinositide-3-kinase, subunitregulator 3 (p55, range) Lipid Kinase PIK3R4 30849 phosphoinositide-3-kinase, subunitregulator 4, p150 Lipid Kinase PIK3R5 23533 phosphoinositide-3-kinase, subunitregulator 5, p101 Lipid Kinase PIK4CA 5297 phosphatidylinositol 4-kinase, catalytic, alpha polypeptide Lipid Kinase PIK4CB 5298 phosphatidylinositol 4-kinase, catalytic, beta polypeptide Lipid Kinase PIM1 5292 oncogene pim-1 protein kinase(RS / TK) PIM2 11040 oncogene pim-2 protein kinase(RS / TK) PINK1 65018 PTEN-induced putative kinase 1 protein kinase(RS / TK) PIP5K1THE 8394 phosphatidylinositol-4-phosphate 5-kinase, type I, alpha Lipid Kinase PIP5K1B 8395 phosphatidylinositol-4-phosphate 5-kinase, type I, beta Lipid Kinase PIP5K2THE 5305 phosphatidylinositol-4-phosphate 5-kinase, type II, alpha Lipid Kinase PIP5K2Ç 79837 phosphatidylinositol-4-phosphate 5-kinase, type II, gamma kinase related PIP5K3 200576 phosphatidylinositol-3-phosphate / phosphatidylinositol Lipid Kinase
Petition 870190065596, of 07/12/2019, p. 89/131
84/120
hGENE GENEID DESCRIPTION KINASE CLASS 5-kinase, type IIIPIP5KL1 138429 phosphatidylinositol-4-phosphate 5-kinase-equivalent 1 Lipid Kinase PKLR 5313 pyruvate kinase, liver and RBC carbohydrate kinase PKM2 5315 pyruvate kinase, muscle carbohydrate kinase PKMYT1 9088 Tyrosine and threonine-specific ccdc-2 inhibitor kinase associated with the membrane protein kinase(NRS / TK) PLAU 5328 Plasminogen activator, urokinase kinase related PLK1 5347 polo-equivalent kinase 1 (Drosophila) protein kinase(NRS / TK) PLK2 10769 polo-equivalent kinase 2 (Drosophila) protein kinase(NRS / TK) PLK4 10733 pole-equivalent kinase 4 (Drosophila) protein kinase(NRS / TK) PLXNA3 55558 plexin A3; PLXNA3 protein kinase (RTK) PLXNA4B 91584 plexin A4, B; PLXNA4B protein kinase (RTK) PLXNB2 23654 plexin B2; PLXNB2 protein kinase (RTK) PMVK 10654 phosphomevalonate kinase kinase related PNCK 139728 CaM kinase not ubiquitously expressed upregulated in pregnancy protein kinase(NRS / TK) PNKP 11284 nucleotide 3'-phosphatase polykinase nucleotide kinase
Petition 870190065596, of 07/12/2019, p. 90/131
85/120
hGENE GENEID DESCRIPTION KINASE CLASS PRKAA1 5562 protein kinase, activated by AMP,alpha catalytic subunit 1 protein kinase(NRS / TK) PRKAA2 5563 protein kinase, activated by AMP,alpha catalytic subunit 2 protein kinase(NRS / TK) PRKAB1 5564 protein kinase, activated by AMP,beta 1 non-catalytic subunit protein kinase(NRS / TK) PRKAB2 5565 protein kinase, activated by AMP, beta 2 non-catalytic subunit protein kinase(NRS / TK) PRKACTHE 5566 protein kinase, cAMP-dependent, catalytic, alpha protein kinase(NRS / TK) PRKACB 5567 protein kinase, cAMP-dependent, catalytic, beta protein kinase(NRS / TK) PRKACG 5568 protein kinase, cAMP-dependent, catalytic, gamma protein kinase(NRS / TK) PRKAG1 5571 protein kinase, activated by AMP,gamma 1 non-catalytic subunit protein kinase(NRS / TK) PRKAG2 51422 protein kinase, activated by AMP,gamma 2 non-catalytic subunit protein kinase(NRS / TK) PRKAG3 53632 protein kinase, activated by AMP,gamma 3 non-catalytic subunit protein kinase(NRS / TK) PRKAR1A 5573 protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue-specific extinguisher 1) protein kinase(NRS / TK) PRKAR1B 5575 protein kinase, cAMP-dependent, regulatory, type I, beta protein kinase(NRS / TK) PRKAR2A 5576 protein kinase, cAMP-dependent, regulatory, type II, alpha protein kinase(NRS / TK)
Petition 870190065596, of 07/12/2019, p. 91/131
86/120
hGENE GENEID DESCRIPTION KINASE CLASS PRKAR2B 5577 protein kinase, cAMP-dependent, regulatory, type II, beta protein kinase(NRS / TK) PRKCA 5578 protein C kinase, alpha protein kinase(NRS / TK) PRKCB1 5579 protein C kinase, beta 1 protein kinase(NRS / TK) PRKCE 5581 protein C kinase, epsilon protein kinase(NRS / TK) PRKCG 5582 protein C kinase, gamma protein kinase(NRS / TK) PRKCH 5583 protein C kinase, eta protein kinase(NRS / TK) PRKCI 5584 protein C kinase, iota protein kinase(NRS / TK) PRKCQ 5588 protein C kinase, theta protein kinase(NRS / TK) PRKCZ 5590 protein C kinase, zeta protein kinase(NRS / TK) PRKD1 5587 protein kinase D1 protein kinase(NRS / TK) PRKD2 25865 protein D2 kinase protein kinase(NRS / TK) PRKD3 23683 protein kinase D3 protein kinase(NRS / TK) PRKG1 5592 protein kinase, cGMP-dependent, type I protein kinase(NRS / TK) PRKG2 5593 protein kinase, dependent on protein kinase
Petition 870190065596, of 07/12/2019, p. 92/131
87/120
hGENE GENEID DESCRIPTION KINASE CLASS cGMP, type II (N RS / TK) PRKR 5610 protein kinase, interferon-inducible double-stranded RNA dependent protein kinase(N RS / TK) PRKX 5613 X-linked protein kinase protein kinase(N RS / TK) PRKY 5616 Y-linked protein kinase protein kinase(N RS / TK) PRPF4B 8899 homologue B of pre-mRNA processing factor 4 PRP4 (yeast) protein kinase(N RS / TK) PRPS1 5631 phosphoribosyl pyrophosphate synthase 1;PRPS1 kinase related PRPS1L1 221823 phosphoribosyl pyrophosphate synthase 1 equivalent 1; PRPS1L1 kinase related PRPS2 5634 phosphoribosyl pyrophosphate synthase 2;PRPS2 kinase related PSKH1 5681 serine protein kinase H1 protein kinase(N RS / TK) PTK2 5747 PTK2 protein tyrosine kinase 2 protein kinase (NRTK) PTK2B 2185 PTK2B protein tyrosine kinase 2 beta protein kinase (NRTK) PTK6 5753 PTK6 protein tyrosine kinase 6 protein kinase (NRTK) PTK7 5754 PTK7 protein tyrosine kinase 7 protein kinase (RTK) PTK9 5756 PTK9 protein tyrosine kinase 9 protein kinase (NRTK)
Petition 870190065596, of 07/12/2019, p. 93/131
88/120
hGENE GENEID DESCRIPTION KINASE CLASS PXK 54899 PX domain containing serine / threonine kinase kinase related RAF1 5894 homologue of viral oncogene 1 of murine leukemia v-raf-1 protein kinase(NRS / TK) RAGE 5891 Renal tumor antigen protein kinase(NRS / TK) RBKS 64080 hbocinase nucleotide kinase RET 5979 proto-oncogene ret (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung's disease) protein kinase (RTK) RFK 55312 hboflavin kinase kinase related RI0K1 83732 RIO kinase 1 (yeast) protein kinase(NRS / TK) RI0K2 55781 RIO kinase 2 (yeast) protein kinase(NRS / TK) RI0K3 8780 RIO kinase 3 (yeast) protein kinase(NRS / TK) RIPK1 8737 sehna-threonine kinase 1 that interacts with the receptor (TNFRSF) protein kinase(NRS / TK) RIPK2 8767 sehna-threonine kinase 2 that interacts with the receptor protein kinase(NRS / TK) RIPK5 25778 protein kinase 5 that interacts with the receptor protein kinase(NRS / TK) RKHD3 84206 Ring finger and KH domain containing 3;RKHD3 protein kinase R0R2 4920 tyrosine-equivalent orphan receptor 2 protein kinase
Petition 870190065596, of 07/12/2019, p. 94/131
89/120
hGENE GENEID DESCRIPTION KINASE CLASS receptor kinase (RTK) RP2 6102 retinitis pigmentosa 2 (X linked in recessive); RP2 nucleotide kinase RP6-213H19,1 51765 kinase related to Mst3 and SOK1 protein kinase RPS6KTO 1 6195 ribosomal protein kinase S6, 90kDa, polypeptide 1 protein kinase(N RS / TK) RPS6KA2 6196 ribosomal protein kinase S6, 90kDa, polypeptide 2 protein kinase(N RS / TK) RPS6KA3 6197 ribosomal protein kinase S6, 90kDa, polypeptide 3 protein kinase(N RS / TK) RPS6KA4 8986 ribosomal protein kinase S6, 90kDa, polypeptide 4 protein kinase(N RS / TK) RPS6KA5 9252 ribosomal protein kinase S6, 90kDa, polypeptide 5 protein kinase(N RS / TK) RPS6KA6 27330 ribosomal protein kinase S6, 90kDa, polypeptide 6 protein kinase(N RS / TK) RPS6KB1 6198 ribosomal protein kinase S6, 70kDa, polypeptide 1 protein kinase(N RS / TK) RPS6KB2 6199 ribosomal protein kinase S6, 70kDa, polypeptide 2 protein kinase(N RS / TK) RPS6KC1 26750 ribosomal protein kinase S6, 52kDa, polypeptide 1 protein kinase(N RS / TK) RPS6KL1 83694 S6 ribosomal protein kinase equivalent 1 protein kinase(N RS / TK) SCIL1 57410 equivalent 1 of SCY1 (S. cerevisiae) protein kinase
Petition 870190065596, of 07/12/2019, p. 95/131
90/120
hGENE GENEID DESCRIPTION KINASE CLASS (NRTK) SCIL2 55681 hypothetical protein FLJ10074 protein kinase (NRTK) SCIL3 57147 Ezrin liaison partner PACE-1 protein kinase (NRTK) SEPHS2 22928 selenophosphate synthase 2; SEPHS2 kinase related SGK 6446 Serum / glucocorticoid regulated kinase protein kinase(NRS / TK) SGK2 10110 Serum / glucocorticoid regulated kinase2 protein kinase(NRS / TK) SGK3 23678 equivalent to serum / glucocorticoid regulated kinase protein kinase(NRS / TK) SH3BP4 23677 binding protein 4 of the SH3 domain;SH3BP4 protein kinase (NRTK) SH3BP5 9467 binding protein 5 of the SH3 domain(associated with BTK); SH3BP5 kinase related SH3BP5L 80851 equivalent of the SH3 domain 5 binding protein; SH3BP5L kinase related SLAMF6 114836 member 6 of the SLAM family; SLAMF6 protein kinase (RTK) SNF1LK 150094 kinase equivalent to SNF1 protein kinase(NRS / TK) SNRK 54861 SNF-1 related kinase protein kinase(NRS / TK) SNX16 64089 nexin 16 of choice; SNX16 kinase related
Petition 870190065596, of 07/12/2019, p. 96/131
91/120
hGENE GENEID DESCRIPTION KINASE CLASS SPHK1 8877 sphingosine kinase 1 carbohydrate kinase SPHK2 56848 sphingosine kinase 2 carbohydrate kinase SRC 6714 homologue of the viral oncogene of v-src sarcoma (Schmidt-Ruppem a-2) (avian) protein kinase (NRTK) SRPK1 6732 SFRS protein kinase 1 protein kinase(NRS / TK) SRPK2 6733 SFRS protein kinase 2 protein kinase(NRS / TK) SRPK3 26576 serine / threonine kinase 23 protein kinase(NRS / TK) STK11 6794 serine / threonine kinase 11 (Peutz-Jeghers syndrome) protein kinase(NRS / TK) STK16 8576 serine / threonine kinase 16 protein kinase(NRS / TK) STK17B 9262 serine / threonine kinase 17b (apoptosis inducer) protein kinase(NRS / TK) STK19 8859 serine / threonine kinase 19 protein kinase(NRS / TK) STK24 8428 serine / threonine kinase 24 (homologousSTE20, yeast) protein kinase STK25 10494 serine / threonine kinase 25 (homologousSTE20, yeast) protein kinase STK3 6788 serine / threonine kinase 3 (homologousSTE20, yeast) protein kinase STK32THE 202374 serine / threonine kinase 32A protein kinase(NRS / TK) STK32 55351 serine / threonine kinase 32B protein kinase
Petition 870190065596, of 07/12/2019, p. 97/131
92/120
hGENE GENEID DESCRIPTION KINASE CLASS B (N RS / TK) STK32Ç 282974 serine / threonine kinase 32C protein kinase(N RS / TK) STK33 65975 serine / threonine kinase 33 protein kinase(N RS / TK) STK36 27148 serine / threonine kinase 36 (fused counterpart, Drosophila) protein kinase(RS / TK) STK38 11329 serine / threonine kinase 38 protein kinase(N RS / TK) STK38L 23012 Equivalent to serine / threonine kinase 38 protein kinase(N RS / TK) STK40 83931 kinase equivalent to Ser / Thr protein kinase STYK1 55359 protein kinase STYK1 protein kinase (RTK) SYK 6850 spleen tyrosine kinase protein kinase (NRTK) TA0K3 51347 TAO kinase 3 protein kinase TBK1 29110 kinase 1 that binds ΤΑΝΚ protein kinase(N RS / TK) TEC 7006 tec protein tyrosine kinase protein kinase (NRTK) TESK1 7016 testis-specific kinase 1 protein kinase(N RS / TK) TESK2 10420 testis-specific kinase 2 protein kinase(N RS / TK) TGFBR1 7046 transforming growth factor, beta I receptor (kinase equivalent to protein kinase(RS / TK)
Petition 870190065596, of 07/12/2019, p. 98/131
93/120
hGENE GENEID DESCRIPTION KINASE CLASS type II activin A receptor, 53kDa)TGFBR2 7048 transforming growth factor, beta II receptor (70/80 kDa) protein kinase(RS / TK) TGFBR3 7049 transforming growth factor, beta III receptor (betaglycan, 300 kDa); TGFBR3 protein kinase(RS / TK) TIE1 7075 domains 1 tyrosine kinase equivalent with immunoglobulin and equivalent to EGF protein kinase (RTK) TK1 7083 thymidine kinase 1, soluble nucleotide kinase TLK1 9874 kinase 1 disorderly equivalent protein kinase(NRS / TK) TLK2 11011 kinase 2 disorderly equivalent protein kinase(NRS / TK) TNK1 8711 tyrosine kinase, non-receptor, 1 protein kinase (NRTK) TNNI3K 51086 kinase that interacts with TNNI3 protein kinase TP53RK 112858 kinase that regulates TP53 protein kinase(NRS / TK) TPK1 27010 thiamine pyrophosphokinase 1 kinase related TPR 7175 Translocated promoter region (for the activated MET oncogene); TPR protein kinase (RTK) TRIB1 10221 homologous 1 tribbles (Drosophila) protein kinase TRIB2 28951 homologous 2 tribbles (Drosophila) protein kinase TRIB3 57761 homologous 3 tribbles (Drosophila) protein kinase TRIM27 5987 containing tripartite motif 27; TRIM27 protein kinase
Petition 870190065596, of 07/12/2019, p. 99/131
94/120
hGENE GENEID DESCRIPTION KINASE CLASS (RTK) TRPM7 54822 Potential cation channel of transient receptor, subfamily M, member 7 protein kinase(NRS / TK) TSSK1 83942 serine / threonine kinase 22D (associated with spermiogenesis) protein kinase(NRS / TK) TSSK2 23617 serine / threonine kinase 22B (associated with spermiogenesis) protein kinase(NRS / TK) TSSK3 81629 22C serine / threonine kinase (associated with spermiogenesis) protein kinase(NRS / TK) TSSK6 83983 serine / threonine kinase protein SSTK protein kinase(NRS / TK) TTK 7272 TTK protein kinase protein kinase TWF2 11344 tyrosine kinase equivalent of PTK9L protein (A6-related protein) protein kinase (NRTK) TXK 7294 TXK tyrosine kinase protein kinase (NRTK) TXNDC3 51314 containing thioredoxin 3 domain (sperm); TXNDC3 nucleotide kinase TYK2 7297 tyrosine kinase 2 protein kinase (NRTK) TYR03 7301 protein tyrosine kinase TYRO3 protein kinase (RTK) UCK2 7371 uridine cytidine kinase 2 nucleotide kinase UHMK1 127933 LI2AF homology motif kinase 1(UHM) protein kinase(NRS / TK) ULK2 9706 unc-51 equivalent kinase 2 (C. protein kinase
Petition 870190065596, of 07/12/2019, p. 100/131
95/120
hGENE GENEID DESCRIPTION KINASE CLASS elegans) (NRS / TK) ULK3 25989 DKFZP434C131 protein protein kinase(NRS / TK) ULK4 54986 hypothetical protein FLJ20574 protein kinase VRK1 7443 vaccinia-related kinase 1 protein kinase(NRS / TK) VRK2 7444 vaccinia-related kinase 2 protein kinase(NRS / TK) VRK3 51231 vaccinia-related kinase 3 protein kinase(NRS / TK) WNK1 65125 protein kinase, deficient in lysine 1 protein kinase(NRS / TK) WNK4 65266 protein kinase, deficient in lysine 4 protein kinase(NRS / TK) XRCC6BP1 91419 XRCC6 binding protein 1;XRCC6BP1 protein kinase XILB 9942 xylulokinase homologue (H. influenzae) carbohydrate kinase YES1 7525 homologue of Yamaguchi sarcoma v-yes-1 viral oncogene 1 protein kinase (NRTK) YSK4 80122 hypothetical protein FLJ23074 protein kinase ZAK 51776 AZK kinase containing sterile alpha motif and leucine zipper protein kinase(NRS / TK) ZAP70 7535 70 kDa protein kinase associated with the zeta chain (TCR) protein kinase (NRTK)
[00165] Table 4: Classification of the average differential proliferation (1 μΜ of PLX4720 / control) for the ORFs related to kinase 597, in relation to MEK DD
Petition 870190065596, of 07/12/2019, p. 101/131
96/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADES - ALL ORFS 44.26% 7.19% - MEK DD 100.00% 6.54% 7.75 (+) ControlRAF1 86.80% 18.00% 5.92 PRKCE 74.76% 8.78% 4.24 MAP3K8 67.51% 10.03% 3.23 PRKCH 67.37% 17.56% 3.21 FGR 65.03% 20.76% 2.89 CRKL 64.74% 19.66% 2.85 PAK3 60.33% 13.59% 2.23 AXL 59.75% 10.23% 2.15 LCK 59.47% 15.66% 2.11 LethalERBB2 59.32% 9.39% 2.09 2 SD = 58.64%PRKCQ 55.40% 11.97% 1.55 NME3 55.10% 15.46% 1.51 MOS 55.04% 11.84% 1.50 KHK 55.03% 14.75% 1.50 TIE1 54.65% 15.26% 1.44 ProliferativePRKAG2 54.23% 7.15% 1.39 LOC91461 53.75% 12.45% 1.32 TYRO3 53.64% 10.57% 1.30 CDK3 53.55% 13.92% 1.29 PIM2 53.36% 10.78% 1.27 CIB4 53.31% 12.21% 1.26 PRPS2 53.24% 14.53% 1.25
Petition 870190065596, of 07/12/2019, p. 102/131
97/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESPRKCB1 53.12% 7.74% 1.23 ACVR1B 53.08% 9.53% 1.23 ETNK2 52.85% 12.63% 1.19 STK36 52.85% 15.28% 1.19 DDR1 52.78% 15.54% 1.19 PRKCA 52.47% 13.38% 1.14 AURKB 52.22% 11.80% 1.11 CAMK4 52.14% 9.09% 1.10 DAPK1 51.94% 11.43% 1.07 AURKC 51.89% 11.23% 1.06 ProliferativeIGF1R 51.35% 10.70% 0.99 FN3K 51.27% 12.65% 0.97 LOC646505 50.97% 16.89% 0.93 PIK3CB 50.90% 12.87% 0.92 YES1 50.68% 9.51% 0.89 LOC340156 50.59% 14.63% 0.88 MAP4K5 50.57% 35.45% 0.88 ABL1 50.55% 19.09% 0.87 MAP2K1IP1 50.47% 11.54% 0.86 PRKAR1B 50.34% 8.31% 0.84 RPS6KA1 50.12% 12.28% 0.81 TSSK6 50.10% 11.70% 0.81 NEK9 50.04% 14.37% 0.80 DLG1 49.98% 12.07% 0.80 PTK6 49.93% 10.93% 0.79 SCIL2 49.85% 12.51% 0.78
Petition 870190065596, of 07/12/2019, p. 103/131
98/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESSTK11 49.82% 12.10% 0.77 C9orf98 49.82% 10.38% 0.77 PCK2 49.77% 12.93% 0.77 NTRK2 49.77% 10.02% 0.77 TRIM27 49.69% 10.38% 0.75 FN3KRP 49.69% 11.83% 0.75 CAMK2D 49.61% 11.93% 0.74 ALPK2 49.56% 10.41% 0.74 LOC652722 49.52% 13.10% 0.73 LATS2 49.49% 12.45% 0.73 STK3 49.48% 10.15% 0.73 CDC42BPG 49.44% 10.19% 0.72 HKDC1 49.44% 11.53% 0.72 CDK7 49.42% 14.45% 0.72 ProliferativeWNK4 49.37% 14.07% 0.71 PRPF4B 49.36% 12.18% 0.71 MAPKAPK2 49.30% 12.83% 0.70 MEKWT 49.29% 14.33% 0.70 (-) ControlPRPS1 49.28% 12.09% 0.70 BTK 49.22% 14.59% 0.69 MYO3B 49.19% 11.05% 0.69 TESK1 49.18% 12.19% 0.68 PLXNA3 49.11% 9.04% 0.67 CLK2 49.09% 8.01% 0.67 PFKFB1 49.02% 14.04% 0.66 DAK 49.00% 12.68% 0.66
Petition 870190065596, of 07/12/2019, p. 104/131
99/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESITPKB 48.99% 16.62% 0.66 CHEK1 48.98% 14.41% 0.66 MERTK 48.94% 12.88% 0.65 IKBKE 48.83% 12.46% 0.63 CARD11 48.83% 15.02% 0.63 PANK3 48.78% 9.70% 0.63 TRIB2 48.76% 10.71% 0.63 CDC7 48.74% 9.83% 0.62 PIK3C3 48.69% 12.05% 0.62 LRGUK 48.60% 11.29% 0.60 SCIL3 48.58% 10.86% 0.60 MAP3K14 48.57% 8.10% 0.60 LOC730000 48.57% 13.36% 0.60 LOC442075 48.55% 10.75% 0.60 LOC54103 48.50% 10.77% 0.59 NPR2 48.49% 13.29% 0.59 COL4A3BP 48.49% 11.10% 0.59 MILK2 48.49% 11.83% 0.59 CSNK2B 48.48% 11.52% 0.59 CARKL 48.47% 9.19% 0.58 TP53RK 48.44% 14.25% 0.58 ProliferativePRKCG 48.42% 8.31% 0.58 ALK 48.39% 14.07% 0.57 ETNK1 48.37% 11.25% 0.57 DYRK2 48.36% 11.80% 0.57 DGKA 48.31% 10.71% 0.56
Petition 870190065596, of 07/12/2019, p. 105/131
100/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESADPGK 48.30% 13.36% 0.56 PRKAB2 48.29% 10.75% 0.56 ULK3 48.28% 11.18% 0.56 KIAA2002 48.28% 12.39% 0.56 IRAK3 48.26% 10.96% 0.56 TYK2 48.24% 10.88% 0.55 MAP2K7 48.23% 12.06% 0.55 NRBP 48.18% 13.40% 0.54 CDK2 48.14% 14.65% 0.54 MORN2 47.98% 11.36% 0.52 EPHB4 47.92% 12.52% 0.51 PRKCZ 47.88% 12.68% 0.50 RFK 47.85% 10.44% 0.50 RAGE 47.83% 10.46% 0.50 LOC91807 47.80% 11.25% 0.49 PIK3CG 47.76% 11.25% 0.49 PIK3C2G 47.74% 10.75% 0.48 ARSG 47.71% 10.26% 0.48 CSNK1A1L 47.66% 10.26% 0.47 ALS2CR7 47.65% 11.56% 0.47 FLJ40852 47.62% 12.34% 0.47 LOC390877 47.61% 11.43% 0.46 TRIB1 47.59% 12.91% 0.46 TPR 47.58% 13.00% 0.46 RPS6KL1 47.57% 12.33% 0.46 CCRK 47.56% 10.28% 0.46
Petition 870190065596, of 07/12/2019, p. 106/131
101/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESPDPK1 47.53% 10.42% 0.45 FASTKD5 47.52% 10.70% 0.45 CDKL3 47.49% 13.14% 0.45 DTYMK 47.49% 10.60% 0.45 MPP3 47.47% 10.65% 0.45 HSPB8 47.46% 11.73% 0.44 NME6 47.44% 14.48% 0.44 NEK3 47.42% 15.46% 0.44 PIK3R4 47.41% 11.14% 0.44 MGC16169 47.41% 13.90% 0.44 OXSR1 47.40% 11.68% 0.44 MASTL 47.35% 10.28% 0.43 PNCK 47.35% 10.15% 0.43 ADCK2 47.32% 15.57% 0.43 SNX16 47.26% 12.76% 0.42 HCK 47.24% 23.41% 0.41 CDKL2 47.21% 10.60% 0.41 NEK11 47.20% 14.68% 0.41 BMP2K 47.15% 11.18% 0.40 BUB1 47.15% 11.76% 0.40 PINK1 47.13% 11.38% 0.40 RBKS 47.08% 8.73% 0.39 LOC732306 47.03% 8.82% 0.39 PKLR 47.03% 12.10% 0.38 DYRK1A 47.01% 12.69% 0.38 RPS6KA4 47.01% 11.70% 0.38
Petition 870190065596, of 07/12/2019, p. 107/131
102/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESDGKG 46.94% 12.71% 0.37 CDK5R1 46.93% 9.40% 0.37 FLJ25006 46.87% 11.64% 0.36 PBK 46.86% 14.05% 0.36 ACVR1C 46.82% 9.98% 0.35 FLT1 46.78% 10.42% 0.35 PLXNA4B 46.76% 9.39% 0.35 MVK 46.71% 9.26% 0.34 LIMK2 46.70% 11.29% 0.34 DYRK1B 46.68% 20.75% 0.34 MARK3 46.67% 11.71% 0.34 ProliferativeBMPR1B 46.66% 12.24% 0.33 NUP62 46.63% 9.92% 0.33 JAK2 46.62% 12.50% 0.33 MAPK12 46.55% 9.98% 0.32 DDR2 46.54% 7.99% 0.32 MAK 46.52% 15.42% 0.31 GLYCTK 46.50% 13.19% 0.31 AK1 46.47% 9.68% 0.31 MAPK15 46.47% 11.14% 0.31 MAST1 46.45% 10.77% 0.30 PAPSS2 46.39% 11.53% 0.30 CSF1R 46.34% 12.86% 0.29 TPK1 46.29% 9.52% 0.28 PAK4 46.24% 9.98% 0.28 NAGK 46.21% 12.34% 0.27
Petition 870190065596, of 07/12/2019, p. 108/131
103/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESCDK8 46.20% 7.68% 0.27 STK40 46.19% 12.92% 0.27 CIB1 46.10% 10.92% 0.26 PLK1 46.08% 9.99% 0.25 FLJ23356 46.04% 10.45% 0.25 LOC220686 46.04% 9.31% 0.25 PRKAB1 46.03% 12.00% 0.25 JAK3 46.02% 10.17% 0.24 NME1 46.02% 13.01% 0.24 NME5 46.00% 11.53% 0.24 FER 45.97% 9.92% 0.24 AK3L1 45.97% 10.39% 0.24 PRKG2 45.90% 13.24% 0.23 RP6-2131-119.1 45.88% 12.83% 0.22 AKT3 45.87% 11.32% 0.22 PSKH1 45.86% 10.16% 0.22 PRKAR2B 45.84% 13.05% 0.22 FUK 45.81% 10.94% 0.22 ADCK4 45.79% 11.25% 0.21 TEC 45.78% 11.46% 0.21 PRKAG1 45.77% 11.08% 0.21 FXN 45.77% 12.03% 0.21 AAK1 45.68% 11.49% 0.20 CAMK2B 45.67% 19.84% 0.20 COASY 45.64% 11.07% 0.19 PRKAG3 45.63% 10.21% 0.19
Petition 870190065596, of 07/12/2019, p. 109/131
104/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESNME7 45.58% 10.18% 0.18 LMTK2 45.58% 12.15% 0.18 PANK2 45.57% 11.72% 0.18 PRKD3 45.47% 13.14% 0.17 PHKA2 45.47% 10.92% 0.17 SLAMF6 45.46% 9.67% 0.17 SRPK1 45.46% 12.54% 0.17 HIPK1 45.42% 12.59% 0.16 EPHA1 45.39% 10.59% 0.16 WNK1 45.38% 13.79% 0.15 PDIK1L 45.33% 12.31% 0.15 BMP2KL 45.33% 10.08% 0.15 MAP3K5 45.32% 14.13% 0.15 EPHA2 45.30% 12.87% 0.14 CCL2 45.29% 9.71% 0.14 CDKL1 45.25% 10.13% 0.14 NJMU-R1 45.23% 8.13% 0.13 LOC652799 45.18% 10.30% 0.13 GUK1 45.15% 12.23% 0.12 NME4 45.12% 13.03% 0.12 YSK4 45.11% 13.47% 0.12 NEK2 45.11% 9.38% 0.12 C9orf95 45.10% 9.38% 0.12 CDC2 45.05% 11.95% 0.11 FGFR2 45.01% 11.23% 0.10 IPMK 44.98% 10.67% 0.10
Petition 870190065596, of 07/12/2019, p. 110/131
105/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESSTK32C 44.98% 12.10% 0.10 PIP5K2A 44.92% 14.55% 0.09 PRKX 44.90% 10.44% 0.09 TRPM7 44.80% 10.36% 0.07 FLJ10986 44.74% 10.95% 0.07 SNF1LK 44.74% 12.70% 0.07 MAP3K6 44.71% 9.75% 0.06 LOC653052 44.70% 14.56% 0.06 IRAK2 44.69% 11.61% 0.06 XILB 44.68% 11.47% 0.06 PTK7 44.67% 14.55% 0.06 PKMYT1 44.66% 13.74% 0.05 SPHK2 44.63% 10.35% 0.05 NME2 44.63% 11.57% 0.05 PRKAA1 44.62% 15.03% 0.05 MAPK14 44.60% 10.77% 0.05 NTRK3 44.58% 13.43% 0.04 PRKACB 44.58% 9.30% 0.04 LOC650122 44.56% 11.24% 0.04 CDK6 44.51% 10.74% 0.03 AMHR2 44.48% 11.11% 0.03 IPPK 44.42% 10.63% 0.02 AK7 44.41% 10.36% 0.02 PIP5KL1 44.36% 11.74% 0.01 LOC340371 44.30% 16.04% 0.01 DKFZp434B1231 44.29% 12.21% 0.00
Petition 870190065596, of 07/12/2019, p. 111/131
106/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESPRKAA2 44.28% 11.42% 0.00 FASTKD1 44.28% 10.73% 0.00 ARAF 44.27% 14.40% 0.00 RAF familyHK3 44.26% 14.83% 0.00 KSR2 44.25% 10.28% 0.00 PAK7 44.24% 18.45% 0.00 GTF2H1 44.23% 10.90% 0.00 RPS6KB2 44.23% 9.32% -0.01 PAK6 44.21% 13.83% -0.01 IRAK4 44.18% 10.27% -0.01 NLK 44.18% 12.92% -0.01 FYN 44.14% 12.43% -0.02 BMPR2 44.14% 12.20% -0.02 CDK4 44.13% 10.47% -0.02 STK32A 44.07% 13.93% -0.03 TNK1 44.06% 10.80% -0.03 STK24 43.99% 10.79% -0.04 CSNK2A1 43.99% 11.97% -0.04 AK3 43.98% 11.16% -0.04 TTK 43.93% 10.47% -0.05 PGK2 43.91% 13.31% -0.05 GALK1 43.89% 10.14% -0.05 DYRK3 43.89% 9.32% -0.05 EIF2AK4 43.83% 11.00% -0.06 PDK1 43.79% 13.31% -0.07 EIF2AK1 43.79% 12.02% -0.07
Petition 870190065596, of 07/12/2019, p. 112/131
107/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESPRKACG 43.79% 11.37% -0.07 BUB1B 43.74% 10.69% -0.07 PKM2 43.74% 14.46% -0.07 LRPPRC 43.64% 10.87% -0.09 EPHA6 43.63% 12.60% -0.09 HK2 43.58% 12.55% -0.10 MET 43.55% 10.99% -0.10 CKS2 43.53% 7.83% -0.10 LOC375133 43.53% 10.05% -0.10 LIMK1 43.52% 12.43% -0.10 TWF2 43.50% 11.71% -0.11 PCTK2 43.47% 12.02% -0.11 DCAKD 43.43% 11.61% -0.12 PLXNB2 43.41% 11.85% -0.12 MST1R 43.35% 11.99% -0.13 PRKAR1A 43.35% 9.03% -0.13 SEPHS2 43.32% 9.68% -0.13 SPHK1 43.31% 9.87% -0.13 CCL4 43.30% 11.83% -0.13 KIAA0999 43.28% 9.68% -0.14 PDGFRL 43.23% 11.93% -0.14 BRSK1 43.21% 14.17% -0.15 BRAF 43.21% 12.56% -0.15 RAF familyMUSK 43.20% 11.03% -0.15 TNNI3K 43.20% 10.46% -0.15 GK2 43.18% 15.15% -0.15
Petition 870190065596, of 07/12/2019, p. 113/131
108/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESCKB 43.14% 9.45% -0.16 DGKB 43.12% 11.62% -0.16 LOC648152 42.99% 11.15% -0.18 RPS6KA5 42.87% 11.23% -0.19 CASK 42.87% 12.05% -0.19 PHKA1 42.86% 10.10% -0.20 AK2 42.84% 9.83% -0.20 PIM1 42.81% 14.09% -0.20 ZAP70 42.81% 12.10% -0.20 PNKP 42.79% 12.95% -0.20 CDK10 42.78% 9.77% -0.21 CHEK2 42.77% 12.86% -0.21 CAMK2A 42.72% 11.68% -0.21 CAMK2G 42.70% 9.66% -0.22 ADRBK2 42.70% 12.56% -0.22 NEK8 42.69% 9.88% -0.22 PRKR 42.69% 10.65% -0.22 CHKA 42.66% 12.84% -0.22 ACVRL1 42.65% 10.85% -0.22 PRKY 42.63% 11.80% -0.23 TRIB3 42.62% 11.45% -0.23 PRKD2 42.59% 10.48% -0.23 PIP5K3 42.57% 9.78% -0.24 LOC727761 42.56% 14.17% -0.24 PTK2B 42.50% 15.72% -0.25 MPP2 42.48% 10.73% -0.25
Petition 870190065596, of 07/12/2019, p. 114/131
109/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESCSNK1A1 42.47% 13.54% -0.25 PTK9 42.42% 11.31% -0.26 STK25 42.41% 12.54% -0.26 PFKL 42.39% 12.01% -0.26 STK19 42.35% 11.20% -0.27 PI4KII 42.30% 14.04% -0.27 HK1 42.26% 12.73% -0.28 AURKA 42.21% 14.80% -0.29 GK5 42.21% 10.98% -0.29 MAP3K7 42.20% 13.13% -0.29 PFTK1 42.18% 12.49% -0.29 ERN1 42.17% 13.74% -0.29 STK33 42.17% 13.22% -0.29 SYK 42.13% 12.42% -0.30 GALK2 42.13% 11.34% -0.30 TSSK1 42.12% 11.98% -0.30 MAPK6 42.11% 10.58% -0.30 ASCIZ 42.07% 10.61% -0.30 PFKP 42.07% 14.99% -0.31 PXK 42.05% 14.69% -0.31 PI4K2B 42.05% 11.84% -0.31 PIP5K2C 42.02% 9.50% -0.31 PFKFB3 42.00% 12.79% -0.31 TSSK3 41.97% 14.82% -0.32 MPP6 41.97% 12.68% -0.32 MPP4 41.87% 12.27% -0.33
Petition 870190065596, of 07/12/2019, p. 115/131
110/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESLOC653155 41.85% 11.50% -0.34 ALPK1 41.82% 12.37% -0.34 CDK9 41.76% 10.32% -0.35 PDK3 41.66% 10.87% -0.36 CKMT2 41.66% 12.57% -0.36 CAMK1G 41.63% 12.06% -0.37 MAPKAPK3 41.61% 13.19% -0.37 PIK4CB 41.55% 14.29% -0.38 PRPS1L1 41.54% 11.08% -0.38 FASTK 41.49% 12.56% -0.39 CAMK1D 41.49% 11.54% -0.39 MARK2 41.48% 14.28% -0.39 PDK4 41.43% 13.43% -0.39 NEK7 41.36% 9.57% -0.40 MAPK4 41.34% 10.83% -0.41 PIK4CA 41.32% 11.99% -0.41 JAK1 41.31% 11.56% -0.41 PDXK 41.30% 11.93% -0.41 TGFBR2 41.25% 15.85% -0.42 PHKB 41.25% 10.81% -0.42 ULK2 41.24% 15.35% -0.42 MKNK1 41.21% 13.08% -0.42 CDC2L6 41.17% 10.91% -0.43 CSNK1G3 41.13% 10.53% -0.44 CAMK1 41.08% 11.68% -0.44 DGKZ 41.07% 12.69% -0.44
Petition 870190065596, of 07/12/2019, p. 116/131
111/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESSGK 40.91% 11.92% -0.47 TBK1 40.83% 14.81% -0.48 ILK 40.81% 12.62% -0.48 STK32B 40.80% 11.79% -0.48 TXNDC3 40.78% 12.24% -0.48 RPS6KB1 40.72% 10.13% -0.49 ZAK 40.71% 10.32% -0.49 DYRK4 40.66% 12.59% -0.50 ITGB1BP3 40.57% 11.99% -0.51 MPP1 40.53% 10.94% -0.52 HIPK2 40.49% 11.06% -0.52 MAPK13 40.46% 12.06% -0.53 TK1 40.39% 11.04% -0.54 SH3BP4 40.36% 12.11% -0.54 CKM 40.29% 12.70% -0.55 FGFRL1 40.23% 16.94% -0.56 MAPK10 40.23% 12.29% -0.56 CALM2 40.16% 8.64% -0.57 CALM3 40.12% 11.85% -0.58 STYK1 40.09% 11.47% -0.58 CDKL4 40.08% 11.01% -0.58 NADK 40.08% 11.89% -0.58 MPP7 40.06% 11.72% -0.59 CAMKV 40.03% 12.16% -0.59 EXOSC10 40.02% 12.78% -0.59 CDKL5 39.98% 10.10% -0.60
Petition 870190065596, of 07/12/2019, p. 117/131
112/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESSTK38 39.90% 9.61% -0.61 INSRR 39.90% 15.08% -0.61 DCK 39.86% 10.23% -0.61 TLK2 39.80% 14.66% -0.62 PCTK3 39.66% 10.48% -0.64 LOC388957 39.65% 10.97% -0.64 PAPSS1 39.59% 13.48% -0.65 ACVR2B 39.56% 14.70% -0.65 NME1-NME2 39.53% 12.01% -0.66 NEK10 39.50% 13.78% -0.66 MAP3K11 39.47% 9.33% -0.67 PMVK 39.46% 10.19% -0.67 MAPK9 39.45% 12.74% -0.67 MKNK2 39.39% 13.54% -0.68 GRK7 39.34% 14.98% -0.68 RIOK2 39.27% 11.79% -0.69 DGKK 39.27% 9.02% -0.69 ACVR1 39.15% 13.96% -0.71 TLK1 39.11% 15.46% -0.72 LATS1 39.05% 10.46% -0.73 SCIL1 39.01% 11.41% -0.73 TESK2 38.93% 13.30% -0.74 DGUOK 38.90% 14.54% -0.75 PGK1 38.87% 12.26% -0.75 MAGI1 38.87% 12.66% -0.75 SNRK 38.79% 11.61% -0.76
Petition 870190065596, of 07/12/2019, p. 118/131
113/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESCALM1 38.65% 10.26% -0.78 RIOK1 38.58% 12.39% -0.79 EEF2K 38.56% 11.96% -0.79 MAPK8 38.45% 10.51% -0.81 CSNK1D 38.44% 15.60% -0.81 ULK4 38.42% 12.02% -0.81 STK38L 38.33% 12.63% -0.83 RIOK3 38.21% 12.80% -0.84 MINK1 38.00% 14.94% -0.87 ROR2 37.95% 15.32% -0.88 PTK2 37.93% 10.59% -0.88 PIK3R5 37.84% 13.17% -0.89 ALDH18A1 37.81% 15.66% -0.90 NYD-SP25 37.79% 13.52% -0.90 MAP4K3 37.76% 9.58% -0.90 AGK 37.61% 13.89% -0.92 GSK3A 37.56% 14.44% -0.93 BMPR1A 37.56% 16.10% -0.93 STK16 37.53% 11.09% -0.94 FASTKD2 37.50% 8.53% -0.94 MAP4K4 37.39% 15.68% -0.96 LRRK2 37.38% 10.11% -0.96 TGFBR3 37.33% 11.04% -0.96 PDGFRB 37.29% 16.90% -0.97 DLG3 37.09% 12.08% -1.00 PFKFB2 36.99% 10.37% -1.01
Petition 870190065596, of 07/12/2019, p. 119/131
114/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESAKT1 36.66% 13.43% -1.06 PRKCI 36.54% 11.44% -1.07 NEK4 36.50% 13.19% -1.08 PRKD1 36.45% 14.57% -1.09 SRPK2 36.37% 12.38% -1.10 SH3BP5 36.37% 17.17% -1.10 CLK1 36.06% 11.13% -1.14 GK 35.86% 17.33% -1.17 IHPK1 35.53% 12.15% -1.21 IHPK3 35.48% 9.30% -1.22 PLAU 35.36% 13.10% -1.24 TAOK3 35.29% 14.78% -1.25 PAK2 35.20% 12.51% -1.26 BMX 35.12% 12.94% -1.27 DAPK2 35.01% 13.92% -1.29 CSNK1E 34.83% 15.21% -1.31 MAPK3 34.75% 19.93% -1.32 LethalMAP3K15 34.40% 16.76% -1.37 LethalMPP5 34.35% 11.80% -1.38 MAST2 34.08% 16.10% -1.42 GRK6 34.04% 15.82% -1.42 DKFZp761P0423 33.93% 13.58% -1.44 VRK1 33.87% 9.28% -1.45 DCAMKL2 33.77% 11.96% -1.46 IHPK2 33.75% 9.56% -1.46 MATK 33.44% 10.25% -1.51
Petition 870190065596, of 07/12/2019, p. 120/131
115/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESRP2 33.20% 13.41% -1.54 MAP2K2 32.98% 15.34% -1.57 UCK2 32.82% 13.75% -1.59 NEK6 32.74% 15.85% -1.60 PRKG1 32.52% 14.60% -1.63 MAP3K12 32.49% 15.33% -1.64 PCTK1 32.48% 13.21% -1.64 MGC42105 32.36% 13.85% -1.66 MAP2K6 32.32% 11.92% -1.66 SH3BP5L 32.11% 15.55% -1.69 FES 32.07% 11.04% -1.70 RKHD3 31.89% 12.45% -1.72 PRKACA 31.76% 18.45% -1.74 LethalMAP4K1 31.51% 13.69% -1.77 CSNK1G1 30.32% 14.90% -1.94 MAPKAPK5 30.15% 13.47% -1.96 CSK 29.83% 14.11% -2.01 LethalBRD3 29.16% 8.83% -2.10 ADRBK1 29.00% 16.93% -2.12 BRSK2 28.64% 13.09% -2.17 ADCK1 28.30% 13.52% -2.22 CSNK1G2 26.81% 14.42% -2.43 CKMT1A 26.80% 12.42% -2.43 TSSK2 25.66% 13.30% -2.59 LethalCD2 25.01% 14.99% -2.68 PIP5K1A 24.76% 15.49% -2.71
Petition 870190065596, of 07/12/2019, p. 121/131
116/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESPHKG1 23.31% 14.24% -2.91 ABL2 Low pLX DNA yield ACVR2A Low pLX DNA yield BLK Low pLX DNA yield CDC2L1 Low pLX DNA yield EGFR Low pLX DNA yield EPHA3 Low pLX DNA yield EPHB1 Low pLX DNA yield ERBB4 Low pLX DNA yield FASTKD3 Low pLX DNA yield FGFR1 Low pLX DNA yield FLT3 Low pLX DNA yield FLT4 Low pLX DNA yield HIPK3 Low pLX DNA yield KSR Low pLX DNA yield LYN Low pLX DNA yield PANK4 Low pLX DNA yield PDGFRA Low pLX DNA yield PLK4 Low pLX DNA yield RET Low pLX DNA yield SGK3 Low pLX DNA yield SRC Low pLX DNA yield TXK Low pLX DNA yield BRD4 Eff. Inf. <70% CAMKK2 Eff. Inf. <70% CKS1B Eff. Inf. <70%
Petition 870190065596, of 07/12/2019, p. 122/131
117/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESCLK3 Eff. Inf. <70% DAPK3 Eff. Inf. <70% EPHA4 Eff. Inf. <70% EPHB6 Eff. Inf. <70% FGFR3 Eff. Inf. <70% FRK Eff. Inf. <70% GCK Eff. Inf. <70% GNE Eff. Inf. <70% HIPK4 Eff. Inf. <70% ITK Eff. Inf. <70% KDR Eff. Inf. <70% LOC389599 Eff. Inf. <70% LOC649288 Eff. Inf. <70% MAP3K2 Eff. Inf. <70% NEK5 Eff. Inf. <70% NTRK1 Eff. Inf. <70% PAK1 Eff. Inf. <70% PHKG2 Eff. Inf. <70% PIK3CA Eff. Inf. <70% PIK3R3 Eff. Inf. <70% PIP5K1B Eff. Inf. <70% RIPK1 Eff. Inf. <70% RIPK2 Eff. Inf. <70% RPS6KA2 Eff. Inf. <70% RPS6KC1 Eff. Inf. <70% STK17B Eff. Inf. <70%
Petition 870190065596, of 07/12/2019, p. 123/131
118/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESTGFBR1 Eff. Inf. <70% UHMK1 Eff. Inf. <70% XRCC6BP1 Eff. Inf. <70% BCKDK STDEV published C1orf57 STDEV published CAMKK1 STDEV published CDC2L2 STDEV published CDK5 STDEV published ERBB3 STDEV published GSG2 STDEV published LOC647279 STDEV published LYK5 STDEV published MAPK1 STDEV published LethalMAP2K5 STDEV published MAP4K2 STDEV published NUAK2 STDEV published PDK2 STDEV published LethalPFKM STDEV published PIK3R1 STDEV published PLK2 STDEV published PRKAR2A STDEV published RPS6KA3 STDEV published RPS6KA6 STDEV published SGK2 STDEV published SRPK3 STDEV published VRK1 STDEV published
Petition 870190065596, of 07/12/2019, p. 124/131
119/120
ORDER GENE AVERAGE DETOURPATTERN Z COUNT GRADESVRK2 STDEV published VRK3 STDEV published
Α375 SKMEL28
Table 5: Result of a secondary screening that quantifies the change in
PLX4720 Glso induced by 9 top candidate resistance ORFs
Secondary Screening
A375 SKMEL28
Gene Glso(μΜ) Multiple changes cias Gho da sific ation 0 Gene GI50(μΜ) multiple changes calssifi cation MAP3K8 > 100.0 598 1 MAP3K8 > 100.0 -100 1 RAF1 > 100.0 598 2 RAF1 > 10.0 > 10 2 CRKL > 10.0 59.8 3 CRKL 9.7 9.7 3 FGR > 10.0 59.8 4 FGR 5 5 4 PRKCE 4.41 26.4 5 PRKCH 2.26 2.26 5 PRKCH 4.14 24.7 6 PRKCE 1.91 1.91 6 ERBB2 1.33 7.95 7 AXL 1.18 1.18 7 AXL 1 5.98 8 ERBB2 1 1 8 PAK3 0.4934 2.95 9 PAK3 0.9041 0.9041 9 Controls Controls Simulated 0.128 50.91Simulated 0.5287 1.89MEK1 0.16171 (-) MEK1 1 1 (-) MEKDD 4.8 28 (+) MEKDD 8.29 8.29 (+)
Petition 870190065596, of 07/12/2019, p. 125/131
Table 6: Patient characteristics
Time Diagnostic time Diagnosis of disease
Age Metastatic primary location
Patient Tissue (years) Gender of Biopsy (years) (years)
SituationBRAF (on SituationBRAF (pre-Treatment response) treatment/post Situation Situation Situationrelapse) NRAS KRAS pMEK pERK
Patient1 Tissue biopsy 49 F Coast 5 3 Patient2 Tissue biopsy 67 M Coast 2 0 Patient3 Tissue biopsyBiopsy 68 M Leg 11 0 MM-R in 38 M Armpit 0 0fabricM307 Short-term culture 59 M LymphAxillary 4 4
answerPartial V600E AT AT AT AT AT answerPartial V600E AT AT AT AT AT answerPartial V600E AT AT AT AT AT answerPartial V600E V600E WT WT * * DiseaseStable V600E V600E AT AT Ref. (14) **
* See Figure 20 ** Vera Figure 3f

权利要求:
Claims (7)
[1]
1. A method of identifying an individual who has cancer who is likely to benefit from treatment with a combination therapy with an RAF inhibitor and a second inhibitor, in which the individual has cancer cells that comprise a B-RAF ^{V600E mutation} , the method characterized by the fact that it comprises:
(a) assay a gene copy number, an mRNA or a protein level or phosphorylation of one or more target kinases selected from the group consisting of MAP3K8 (TPL2 / COT), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2), AXL (Axl), or PAK3 (Pak3) in cancer cells obtained from the individual and compare the gene copy number, mRNA or protein level or phosphorylation with a gene copy number, an mRNA or a level of protein or phosphorylation of the target kinase in cells obtained from an individual without cancer; and (b) correlating the increased gene copy number or a change in mRNA expression or overexpression or phosphorylation of the target kinase protein in the cancer cells in relation to the cells of the individual without the cancer with the individual who has the cancer that you are likely to benefit from treatment with combination therapy.
[2]
2. Method according to claim 1, characterized in that it comprises testing the gene copy number, mRNA or protein level of MAP3K8 (TPL / COT).
[3]
Method according to any one of claims 1 to 2, characterized in that the second inhibitor is a MEK inhibitor, a CRAF inhibitor, a CrkL inhibitor or a TPL2 / COT inhibitor.
[4]
Method according to any one of claims 1 to 3, characterized in that the RAF inhibitor is a B-RAF inhibitor or a pan-RAF inhibitor, preferably in which the RAF inhibitor is selected from the group that consists of RAF265, sorafenib, SB590885, PLX 4720, PLX4032, GDC0879 and ZM 336372.
Petition 870190065596, of 07/12/2019, p. 127/131
2/2
[5]
Method according to any one of claims 1 to 4, characterized in that the individual has innate resistance to the RAF inhibitor or is likely to develop resistance to the RAF inhibitor.
[6]
6. Method according to any one of claims 1 to 5, characterized in that the cancer is selected from the group consisting of melanoma, breast cancer, colorectal cancers, glioma, lung cancer, ovarian cancer, sarcoma and thyroid cancer , preferably in which the cancer is melanoma.
[7]
7. Use of an effective amount of an RAF inhibitor and an effective amount of a second inhibitor, in which the second inhibitor is a MAP3K8 inhibitor (TPL2 / COT), characterized by the fact that it is in the manufacture of a drug to treat cancer in an individual in need thereof, the individual having cancer cells that comprise a B-RAF ^{V600E mutation} and the individual having cancer cells comprising an increased gene copy number or a change in mRNA expression or protein overexpression or phosphorylation of the target kinase in cancer cells, the target kinases selected from the group consisting of MAP3K8 (TPL2 / COT), CRKL (CrkL), FGR (Fgr), PRKCE (Prkce), PRKCH (Prkch), ERBB2 (ErbB2), AXL ( Axl), or PAK3 (Pak3).

类似技术:

---

公开号 | 公开日 | 专利标题

---

US11078540B2|2021-08-03|Methods of diagnosing and treating cancer in patients having or developing resistance to a first cancer therapy

---

Matthews et al.2011|Targeting protein kinases for cancer therapy

---

TWI656875B|2019-04-21|Treatment of cancer with dihydropyrazino-pyrazines

---

US20110008347A1|2011-01-13|Cancer-related protein kinases

---

JP6254630B2|2017-12-27|MEK1 mutations that confer resistance to RAF and MEK inhibitors

---

JP6661685B2|2020-03-11|C-RAF mutants conferring resistance to RAF inhibitors

---

US20210318318A1|2021-10-14|Kinase Activity In Tumors

---

Bhat et al.2020|The Dopamine Receptor Antagonist TFP Prevents Phenotype Conversion and Improves Survival in Mouse Models of Glioblastoma

---

Huo et al.2021|Lung cancer driven by BRAFG469V mutation is targetable by EGFR kinase inhibitors

---

CN107091930B|2020-09-15|Method for rapidly predicting and improving sensitivity of non-small cell lung cancer cells to epidermal growth factor receptor inhibitor

---

WO2020140927A1|2020-07-09|Cancer treatment using multi-targeted kinase inhibitor in combination of protein kinase biomarkers

---

Prahallad et al.2012|The final version is available at

---

Ausland2016|Regulation of Glioblastoma Multiforme Physiology by Protein Kinase A Inhibition

---

Sherman Jr2020|A Metabolic Checkpoint in G2 Regulates Mitotic Entry in Response to Metabolic Stress

---

WO2020176693A2|2020-09-03|Methods for treating map3k8 positive cancers

---

Markegard2018|Oncogene-mediated inhibition of the Spred1 tumor suppressor

---

Varghese2016|Novel Prognostic Markers and Therapeutic Targets for Glioblastoma

---

Waal2016|Phenotypic drug discovery & predictive chemogenomics: identification of a novel phosphodiesterase 3a modulator

---

Koncar2017|Exploiting genetic vulnerabilities to overcome treatment resistance in adult gliomas

---

Mangoni et al.2016|Basic Knowledge of Glioblastoma Radiobiology

---

Singh2008|Novel role of the JAK-STAT pathway in mediating the effects of atypical antipsychotics on 5-HT2A receptor signaling

---

Hutz2010|Genetic analysis of the PI3k/AKT/mTOR signaling pathway

---

Cooper2013|Kinome Profiling of Drug-Resistant Myeloid Leukemia to Guide the Use of Targeted Therapy

同族专利:

---

公开号 | 公开日

---

MX343368B|2016-11-01|

---

WO2011112678A1|2011-09-15|

---

MX2012010420A|2012-11-30|

---

EA030276B1|2018-07-31|

---

US20210404014A1|2021-12-30|

---

JP5985401B2|2016-09-06|

---

AU2011224410A1|2012-09-20|

---

EP2545187B1|2018-09-05|

---

JP2013526843A|2013-06-27|

---

AU2011224410B2|2015-05-28|

---

CA2791247A1|2011-09-15|

---

EA201290883A1|2013-04-30|

---

BR112012022801A2|2017-01-10|

---

CA2791247C|2019-05-14|

---

US20170268069A1|2017-09-21|

---

US11078540B2|2021-08-03|

---

CN103038364A|2013-04-10|

---

US20130059851A1|2013-03-07|

---

ES2714875T3|2019-05-30|

---

KR20120139767A|2012-12-27|

---

EP2545187A1|2013-01-16|

---

BR112012022801B8|2019-10-29|

引用文献:

---

公开号 | 申请日 | 公开日 | 申请人 | 专利标题

---

---

IL63907D0|1980-09-24|1981-12-31|Cetus Corp|Diagnostic method and antibody probe for use therein|

---

AT53862T|1982-01-22|1990-06-15|Cetus Corp|METHOD FOR CHARACTERIZING HLA AND THE CDNS TEST AGENTS USED IN IT.|

---

US4683202B1|1985-03-28|1990-11-27|Cetus Corp|

---

CA1284931C|1986-03-13|1991-06-18|Henry A. Erlich|Process for detecting specific nucleotide variations and genetic polymorphisms present in nucleic acids|

---

CA1338457C|1986-08-22|1996-07-16|Henry A. Erlich|Purified thermostable enzyme|

---

EP0266032A1|1986-08-29|1988-05-04|Beecham Group Plc|Modified fibrinolytic enzyme|

---

FR2650840B1|1989-08-11|1991-11-29|Bertin & Cie|RAPID DETECTION AND / OR IDENTIFICATION OF A SINGLE BASED ON A NUCLEIC ACID SEQUENCE, AND ITS APPLICATIONS|

---

US7705215B1|1990-04-17|2010-04-27|Dekalb Genetics Corporation|Methods and compositions for the production of stably transformed, fertile monocot plants and cells thereof|

---

US6004744A|1991-03-05|1999-12-21|Molecular Tool, Inc.|Method for determining nucleotide identity through extension of immobilized primer|

---

GB9222888D0|1992-10-30|1992-12-16|British Tech Group|Tomography|

---

AT404556B|1995-11-23|1998-12-28|Pharma Consult Gmbh|Device for tightly sealing a glass or plastic container for admitting liquid pharmaceutical products|

---

GB2323845A|1997-03-31|1998-10-07|Merck & Co Inc|MEK inhibiting lactones|

---

NZ501276A|1997-07-01|2000-10-27|Warner Lambert Co|4-bromo or 4-iodo phenylamino benzhydroxamic acid derivatives and their use as MEK inhibitors in treating proliferative disorders|

---

US6506798B1|1997-07-01|2003-01-14|Warner-Lambert Company|4-Arylamino, 4-aryloxy, and 4-arylthio diarylamines and derivatives thereof as selective MEK inhibitors|

---

US6310060B1|1998-06-24|2001-10-30|Warner-Lambert Company|2- benzoic acid derivatives and their use as MEK inhibitors|

---

US6821963B2|1997-07-01|2004-11-23|Warner-Lambert Company|4-Bromo or 4-iodo phenylamino benzhydroxamic acid derivatives and their use as MEK inhibitors|

---

EP0993437B1|1997-07-01|2006-11-08|Warner-Lambert Company Llc|2- benzoic acid derivatives and their use as mek inhibitors|

---

US20040171632A1|1998-12-22|2004-09-02|Gowan Richard Carleton|Combination chemotherapy|

---

DE69928568T2|1998-12-22|2006-07-27|Warner-Lambert Co. Llc|CHEMOTHERIAPY WITH ANTIMITOTIC AGENT AND MEK INHIBITOR|

---

EA200100773A1|1999-01-13|2002-02-28|Варнер-Ламберт Компани|SUBSTITUTED 1-HETEROCYCLIC DIARYLAMINES|

---

CA2348236A1|1999-01-13|2000-07-20|Stephen Douglas Barrett|4-arylamino, 4-aryloxy, and 4-arylthio diarylamines and derivatives thereof as selective mek inhibitors|

---

AT311363T|1999-01-13|2005-12-15|Warner Lambert Co|Sulphohydroxamic acid and sulphohydroxamates and their use as inhibitors of MEK inhibition|

---

JP2000204079A|1999-01-13|2000-07-25|Warner Lambert Co|Diarylamine|

---

JP2000204075A|1999-01-13|2000-07-25|Warner Lambert Co|Diarylamine|

---

CZ20012498A3|1999-01-13|2002-08-14|Warner-Lambert Company|Benzoheterocyclic compounds and their use as MEK inhibitors|

---

DE69928286T2|1999-01-13|2006-07-13|Warner-Lambert Co. Llc|BENZENESULFONAMIDE DERIVATIVES AND THEIR USE AS MEK INHIBITORS|

---

JP2000212157A|1999-01-13|2000-08-02|Warner Lambert Co|Diarylamine|

---

JP2000204077A|1999-01-13|2000-07-25|Warner Lambert Co|Diarylamine|

---

DK1301472T3|2000-07-19|2014-04-07|Warner Lambert Co|Oxygenated esters of 4-iodo-phenylamino-benzhydroxamic acids|

---

US7253199B2|2001-10-23|2007-08-07|Applied Research Systems Ars Holding N.V.|Azole derivatives and pharmaceutical compositions containing them|

---

JP2005526008A|2001-12-04|2005-09-02|オニックスファーマシューティカルズ，インコーポレイティド|RAF-MEK-ERK pathway inhibitors for treating cancer|

---

WO2003047585A1|2001-12-05|2003-06-12|Astrazeneca Ab|Pharmaceutical compositions comprising benzofuranyl substituted 3-cyanoquinoline derivatives and their use for the treatment of solid tumours|

---

AU2002365665A1|2001-12-05|2003-06-17|Astrazeneca Ab|Pharmaceutical compositions comprising benzofuranyl substituted 3-cyanoquinoline derivatives and their use for the treatment of solid tumours|

---

DOP2003000556A|2002-01-23|2003-10-31|Warner Lambert Co|ESTERES HYDROXAMATE ACID N- -ANTRANILICO.|

---

MXPA04005527A|2002-01-23|2005-03-23|Warner Lambert Co|N--anthranilic acid hydroxamate esters.|

---

EP1482944A4|2002-03-13|2006-04-19|Array Biopharma Inc|N3 alkylated benzimidazole derivatives as mek inhibitors|

---

US6989451B2|2002-06-04|2006-01-24|Valeant Research & Development|Heterocyclic compounds and uses thereof|

---

SI1509230T1|2002-06-05|2007-06-30|Cedars Sinai Medical Center|Gefitinib for the treatment of cancer|

---

US7232826B2|2002-09-30|2007-06-19|Bristol-Myers Squibb Company|Tyrosine kinase inhibitors|

---

AU2003287366A1|2002-10-31|2004-06-07|University Of Rochester|Hyfroxyflutamide induced pathways related to androgen receptor negative prostate cancer cells|

---

GB0225579D0|2002-11-02|2002-12-11|Astrazeneca Ab|Chemical compounds|

---

AU2003291268A1|2002-11-12|2004-06-03|Mercury Therapeutics, Inc.|Xanthene compounds for cancer chemotherapy|

---

US20050004186A1|2002-12-20|2005-01-06|Pfizer Inc|MEK inhibiting compounds|

---

RU2325159C2|2003-03-11|2008-05-27|Новартис Аг|Use of isohinilin derivatives for treatment of cancer and map kinase related diseases|

---

WO2005000818A1|2003-06-27|2005-01-06|Warner-Lambert Company Llc|5-substituted-4-`!amino!-2-pyridone deviatives for use as mek inhibitors|

---

WO2005007616A1|2003-07-23|2005-01-27|Warner-Lambert Company Llc|Diphenylamino ketone derivatives as mek inhibitors|

---

US20050049276A1|2003-07-23|2005-03-03|Warner-Lambert Company, Llc|Imidazopyridines and triazolopyridines|

---

DE602004023207D1|2003-07-24|2009-10-29|Warner Lambert Co|BENZIMIDAZOLE DERIVATIVES AS MEK INHIBITORS|

---

US7538120B2|2003-09-03|2009-05-26|Array Biopharma Inc.|Method of treating inflammatory diseases|

---

US7144907B2|2003-09-03|2006-12-05|Array Biopharma Inc.|Heterocyclic inhibitors of MEK and methods of use thereof|

---

EP1674452A4|2003-09-19|2007-10-10|Chugai Pharmaceutical Co Ltd|Novel 4-phenylamino-benzaldoxime derivative and use thereof as mek inhibitor|

---

EP1682126B1|2003-10-16|2009-07-01|Novartis Vaccines and Diagnostics, Inc.|Substituted benzazoles and use thereof as inhibitors of raf kinase|

---

US7517994B2|2003-11-19|2009-04-14|Array Biopharma Inc.|Heterocyclic inhibitors of MEK and methods of use thereof|

---

WO2005051300A2|2003-11-19|2005-06-09|Array Biopharma Inc.|Bicyclic inhibitors of mek and methods of use thereof|

---

US7732616B2|2003-11-19|2010-06-08|Array Biopharma Inc.|Dihydropyridine and dihydropyridazine derivatives as inhibitors of MEK and methods of use thereof|

---

TW200529846A|2004-02-20|2005-09-16|Wyeth Corp|3-quinolinecarbonitrile protein kinase inhibitors|

---

AT383360T|2004-06-11|2008-01-15|Japan Tobacco Inc|5-AMINO-2,4,7-TRIOXO-3,4,7,8-TETRAHYDRO-2H-PYRIDO pyrimidine derivatives and related compounds for the treatment of cancers|

---

US7378423B2|2004-06-11|2008-05-27|Japan Tobacco Inc.|Pyrimidine compound and medical use thereof|

---

TWI361066B|2004-07-26|2012-04-01|Chugai Pharmaceutical Co Ltd|5-substituted-2-phenylamino benzamides as mek inhibitors|

---

CN101006085A|2004-08-17|2007-07-25|霍夫曼-拉罗奇有限公司|Substituted hydantoins|

---

EP1781649B1|2004-08-17|2008-08-13|F. Hoffmann-Roche AG|Substituted hydantoins|

---

CN101654452A|2004-08-25|2010-02-24|塔尔基公司|Heterocyclic compounds and methods of use.|

---

PL382308A1|2004-08-25|2007-08-20|Targegen, Inc.|Heterocyclic compounds and the manners of use|

---

CA2577278A1|2004-09-01|2006-03-09|Astrazeneca Ab|Quinazolinone derivatives and their use as b-raf inhibitors|

---

JP2006083133A|2004-09-17|2006-03-30|Sankyo Co Ltd|Medicinal composition of sulfamide derivative|

---

TW200621766A|2004-09-17|2006-07-01|Hoffmann La Roche|Substituted hydantoins|

---

US7956191B2|2004-10-20|2011-06-07|Merck Serono Sa|3-arylamino pyridine derivatives|

---

US20070293544A1|2004-11-24|2007-12-20|Ulrich Abel|Novel 4-Arylamino Pyridone Derivatives as Mek Inhibitors for the Treatment of Hyper-Proliferative Disorders|

---

AT443063T|2004-12-01|2009-10-15|Merck Serono Sa|Ä1,2,4ÜTRIAZOLOÄ4,3-AÜPYRIDIN DERIVATIVE FOR THE TREATMENT OF HYPERPROLIFERATIVE DISEASES|

---

US7429667B2|2005-01-20|2008-09-30|Ardea Biosciences, Inc.|Phenylamino isothiazole carboxamidines as MEK inhibitors|

---

CN101626767A|2005-05-18|2010-01-13|阵列生物制药公司|The heterocycle inhibitor of MEK and using method thereof|

---

WO2006133417A1|2005-06-07|2006-12-14|Valeant Pharmaceuticals International|Phenylamino isothiazole carboxamidines as mek inhibitors|

---

US8101799B2|2005-07-21|2012-01-24|Ardea Biosciences|Derivatives of N- sulfonamides as inhibitors of MEK|

---

EP2175885B1|2007-07-30|2016-10-12|Ardea Biosciences, Inc.|Combinations of mek inhibitors and raf kinase inhibitors and uses thereof|

---

DK1912636T3|2005-07-21|2014-07-21|Ardea Biosciences Inc|N- -SULPHONAMIDE INHIBITORS OF MEK|

---

US20070049591A1|2005-08-25|2007-03-01|Kalypsys, Inc.|Inhibitors of MAPK/Erk Kinase|

---

CA2662285A1|2006-08-31|2008-03-06|Array Biopharma Inc.|Raf inhibitor compounds and methods of use thereof|

---

ES2365070T3|2005-10-07|2011-09-21|Exelixis, Inc.|AZETIDINS WITH MEK INHIBITORS FOR THE TREATMENT OF PROLIFERATIVE DISEASES.|

---

CN101341132A|2005-12-21|2009-01-07|阿斯利康有限公司|Tosylate salt of 6- -7-fluoro-n- -3-methyl-3h-benzimi dazole- 5 - carboxamide , mek inhibitor useful in the treatment of cancer|

---

US7612212B2|2006-02-22|2009-11-03|Hoffmann-La Roche Inc.|Substituted hydantoins|

---

EP2007736A1|2006-04-05|2008-12-31|AstraZeneca AB|Substituted quinazolines with anti-cancer activity|

---

US7842836B2|2006-04-11|2010-11-30|Ardea Biosciences|N-aryl-N'alkyl sulfamides as MEK inhibitors|

---

MX2008013097A|2006-04-18|2008-10-27|Ardea Biosciences Inc|Pyridone sulfonamides and pyridone sulfamides as mek inhibitors.|

---

MX2008013308A|2006-04-19|2008-10-27|Serono Lab|Novel heteroaryl-substituted arylaminopyridine derivatives as mek inhibitors.|

---

WO2007123939A2|2006-04-19|2007-11-01|Laboratoires Serono S.A.|Novel arylamino n-heteraryls as mek inhibitors|

---

US20100075947A1|2006-08-16|2010-03-25|Exelixis, Inc.|Methods of Using PI3K and MEK Modulators|

---

WO2008020203A1|2006-08-17|2008-02-21|Astrazeneca Ab|Pyridinylquinaz0linamine derivatives and their use as b-raf inhibitors|

---

WO2008024725A1|2006-08-21|2008-02-28|Genentech, Inc.|Aza-benzofuranyl compounds and methods of use|

---

WO2008024724A1|2006-08-21|2008-02-28|Genentech, Inc.|Aza-benzothiophenyl compounds and methods of use|

---

CA2667961A1|2006-10-31|2008-05-08|Takeda Pharmaceutical Company Limited|Mapk/erk kinase inhibitors|

---

TW200829586A|2006-11-30|2008-07-16|Genentech Inc|Aza-indolyl compounds and methods of use|

---

EP2101759B1|2006-12-14|2018-10-10|Exelixis, Inc.|Methods of using mek inhibitors|

---

WO2008120004A1|2007-04-02|2008-10-09|Astrazeneca Ab|Combination of a mek- inhibitor and a b-raf inhibitor for the treatment of cancer|

---

WO2009002607A1|2007-05-01|2008-12-31|Dana-Farber Cancer Institute, Inc.|Compositions and methods for identifying transforming and tumor suppressor genes|

---

WO2010068738A1|2008-12-10|2010-06-17|Dana-Farber Cancer Institute, Inc.|Mek mutations conferring resistance to mek inhibitors|

---

SI2488033T1|2009-10-16|2019-10-30|Novartis Ag|Combination comprising an MEK inhibitor and a B-raf inhibitor|US7723477B2|2005-10-31|2010-05-25|Oncomed Pharmaceuticals, Inc.|Compositions and methods for inhibiting Wnt-dependent solid tumor cell growth|

---

SG190568A1|2008-09-26|2013-06-28|Oncomed Pharm Inc|Frizzled-binding agents and uses thereof|

---

TWI535445B|2010-01-12|2016-06-01|安可美德藥物股份有限公司|Wnt antagonists and methods of treatment and screening|

---

US8551789B2|2010-04-01|2013-10-08|OncoMed Pharmaceuticals|Frizzled-binding agents and their use in screening for WNT inhibitors|

---

AU2012240240A1|2011-04-04|2013-05-09|Netherlands Cancer Institute|Methods and compositions for predicting resistance to anticancer treatment with protein kinase inhibitors|

---

US10202643B2|2011-10-31|2019-02-12|University Of Utah Research Foundation|Genetic alterations in glioma|

---

US20150132301A1|2011-12-09|2015-05-14|Oncomed Pharmaceuticals, Inc.|Combination Therapy for Treatment of Cancer|

---

CA2864169A1|2012-03-28|2013-10-03|Caroline Emery|C-raf mutants that confer resistance to raf inhibitors|

---

CA2879252C|2012-08-17|2017-10-10|F. Hoffmann-La Roche Ag|Combination therapies for melanoma comprising administering cobimetinib and vemurafinib|

---

WO2014066328A1|2012-10-23|2014-05-01|Oncomed Pharmaceuticals, Inc.|Methods of treating neuroendocrine tumors using wnt pathway-binding agents|

---

WO2014121196A1|2013-02-04|2014-08-07|Oncomed Pharmaceuticals, Inc.|Methods and monitoring of treatment with a wnt pathway inhibitor|

---

US9168300B2|2013-03-14|2015-10-27|Oncomed Pharmaceuticals, Inc.|MET-binding agents and uses thereof|

---

WO2014150671A1|2013-03-15|2014-09-25|The Broad Institute, Inc.|Methods of identifying responses to map kinase inhibition therapy|

---

WO2014204261A1|2013-06-21|2014-12-24|사회복지법인 삼성생명공익재단|Pharmaceutical composition containing tp12 expression inhibitor or activity inhibitor as active ingredient for preventing or treating renal cell cancer|

---

WO2016041932A1|2014-09-17|2016-03-24|Institut Curie|Map3k8 as a marker for selecting a patient affected with an ovarian cancer for a treatment with a mek inhibitor|

---

KR20160129609A|2015-04-30|2016-11-09|삼성전자주식회사|Composition for reducing senescence of a cell or a subject comprising BRAF inhibitor and use thereof|

---

KR102073641B1|2015-07-06|2020-02-05|길리애드 사이언시즈, 인코포레이티드|Cot modulators and methods of use thereof|

---

PT3319955T|2015-07-06|2021-01-05|Gilead Sciences Inc|6-amino-quinoline-3-carbonitrils as cot modulators|

---

CN105695616A|2016-04-22|2016-06-22|王冬国|Analysis marker for diagnosing thyroid cancer and application thereof|

---

US10059695B2|2016-06-30|2018-08-28|Gilead Sciences, Inc.|Cot modulators and methods of use thereof|

---

WO2018027223A1|2016-08-05|2018-02-08|Duke University|Camkk2 inhibitor compositions and methods of using the same|

---

AU2017384617A1|2016-12-20|2019-06-13|Eth Zurich|Identification of drugs targeting non-genetic drug tolerance programs in cancer|

---

US10793901B2|2016-12-28|2020-10-06|Roche Molecular Systems, Inc.|Reversibly protected nucleotide reagents with high thermal stability|

---

WO2018134254A1|2017-01-17|2018-07-26|Heparegenix Gmbh|Protein kinase inhibitors for promoting liver regeneration or reducing or preventing hepatocyte death|

---

CN108872438B|2018-08-06|2021-01-15|杭州迪相实业有限公司|Rapid detection kit for lung cancer marker GK5 in exosome|

---

EP3876930A1|2018-11-07|2021-09-15|Dana-Farber Cancer Institute, Inc.|Benzimidazole derivatives and aza-benzimidazole derivatives as janus kinase 2 inhibitors and uses thereof|

---

EP3931564A2|2019-02-26|2022-01-05|Cell Response, Inc.|Methods for treating map3k8 positive cancers|

---

TW202112766A|2019-06-14|2021-04-01|美商基利科學股份有限公司|Cot modulators and methods of use thereof|

---

CN110862968A|2019-10-30|2020-03-06|中国农业科学院兰州兽医研究所|Construction method and application of PK-15 cell line knocked out by MAP3K8 gene|

法律状态:
2017-12-12| B07D| Technical examination (opinion) related to article 229 of industrial property law [chapter 7.4 patent gazette]|Free format text: DE ACORDO COM O ARTIGO 229-C DA LEI NO 10196/2001, QUE MODIFICOU A LEI NO 9279/96, A CONCESSAO DA PATENTE ESTA CONDICIONADA A ANUENCIA PREVIA DA ANVISA. CONSIDERANDO A APROVACAO DOS TERMOS DO PARECER NO 337/PGF/EA/2010, BEM COMO A PORTARIA INTERMINISTERIAL NO 1065 DE 24/05/2012, ENCAMINHA-SE O PRESENTE PEDIDO PARA AS PROVIDENCIAS CABIVEIS. |

---

2018-04-10| B06F| Objections, documents and/or translations needed after an examination request according [chapter 6.6 patent gazette]|

---

2019-04-16| B07E| Notification of approval relating to section 229 industrial property law [chapter 7.5 patent gazette]|Free format text: NOTIFICACAO DE ANUENCIA RELACIONADA COM O ART 229 DA LPI |

---

2019-05-14| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2019-05-21| B06T| Formal requirements before examination [chapter 6.20 patent gazette]|

---

2019-06-04| B06I| Publication of requirement cancelled [chapter 6.9 patent gazette]|Free format text: ANULADA A PUBLICACAO CODIGO 6.20 NA RPI NO 2524 DE 21/05/2019 POR TER SIDO INDEVIDA. |

---

2019-08-06| B09A| Decision: intention to grant [chapter 9.1 patent gazette]|

---

2019-10-15| B16A| Patent or certificate of addition of invention granted [chapter 16.1 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 09/03/2011, OBSERVADAS AS CONDICOES LEGAIS. (CO) 20 (VINTE) ANOS CONTADOS A PARTIR DE 09/03/2011, OBSERVADAS AS CONDICOES LEGAIS |

---

2019-10-29| B16C| Correction of notification of the grant [chapter 16.3 patent gazette]|Free format text: PRAZO DE VALIDADE: 20 (VINTE) ANOS CONTADOS A PARTIR DE 09/03/2011, OBSERVADAS AS CONDICOES LEGAIS. (CO) REFERENTE A RPI 2545 DE 15/10/2019, QUANTO AO ITEM (30) PRIORIDADE UNIONISTA. |

---

2021-03-30| B21F| Lapse acc. art. 78, item iv - on non-payment of the annual fees in time|Free format text: REFERENTE A 10A ANUIDADE. |

---

2021-08-10| B24J| Lapse because of non-payment of annual fees (definitively: art 78 iv lpi, resolution 113/2013 art. 12)|Free format text: EM VIRTUDE DA EXTINCAO PUBLICADA NA RPI 2621 DE 30-03-2021 E CONSIDERANDO AUSENCIA DE MANIFESTACAO DENTRO DOS PRAZOS LEGAIS, INFORMO QUE CABE SER MANTIDA A EXTINCAO DA PATENTE E SEUS CERTIFICADOS, CONFORME O DISPOSTO NO ARTIGO 12, DA RESOLUCAO 113/2013. |

优先权:

---

申请号 | 申请日 | 专利标题

---

US31219310P| true| 2010-03-09|2010-03-09|

---

US61/312,193|2010-03-09|

---

US31251910P| true| 2010-03-10|2010-03-10|

---

US61/312,519|2010-03-10|

---

US32602110P| true| 2010-04-20|2010-04-20|

---

US61/362,021|2010-07-07|

---

US41556910P| true| 2010-11-19|2010-11-19|

---

US61/415,569|2010-11-19|

---

PCT/US2011/027689|WO2011112678A1|2010-03-09|2011-03-09|Methods of diagnosing and treating cancer in patients having or developing resistance to a first cancer therapy|

---